The effect of monovalent cations on the association behavior of guanosine 5'-monophosphate, cytidine 5'-monophosphate, and their equimolar mixture in aqueous solution

¹H- and ³¹P-nmr spectroscopy have been used to investigate the self-association of M₂(5′-CMP) [M = Li⁺, Na⁺, K⁺, Rb⁺, or (CH₃)₄ N⁺; 5′-CMP = cytidine 5′-monophosphate], the self-association of Li₂(5′-GMP) (5′-GMP = guanosine 5′-monophosphate), and the heteroassociation of 5′-GMP and 5′-CMP (1 : 1 mole ratio) in aqueous solution as a function of the nature of the monovalent cation. Proton spectral differences for the different 5′-CMP salts exhibit a cation-size dependence and have been ascribed to a change in the stacking geometry. An average stacking association constant of 0.63 ± 0.24M^?1 at 1°C, consistent with the weak stacking interactions of the cytosine bases, was determined for the 5′-CMP salts. Heteroassociation of 5′-GMP and 5′-CMP follows the reverse of the cation order for the formation of ordered aggregates of 5′-GMP. Heteroassociation occurs in the presence of Li⁺, Na⁺, and Rb⁺ ions, but only self-association occurs for the K⁺ nucleotides. Li₂(5′-GMP), which does not form ordered species, self-associates to form disordered base stacks with a stacking constant of 1.63 ± 0.11M^?1 at 1°C.     

P-CHIRAL OLIGONUCLEOTIDES. 2D ROESY NMR ASSIGNMENT OF ABSOLUTE CONFIGURATION AT PHOSPHORUS AND CONFORMATIONAL ANALYSIS OF 5′-O-MONOMETHOXYTRITYL-(2′-O-DEOXYRIBONUCLEOSIDE) 3′-O-[O-(4-NITROPHENYL)]METHANEPHOSPHONATES

ABSTRACT

Fast and simple methodology for the assignment of the absolute configuration at the phosphorus atom in diastereomerically pure R_P and S_P 5′-O-monomethoxytrityl-2′-O-deoxynucleoside 3′-O-(O-4-nitrophenyl)methanephosphonate (3) was established. The method utilizes 2D ROESY NMR and can be used for the stereochemical analysis of other P-chiral mononucleotides. Configurational analysis shows that the major conformation of the sugar residue in 3 is of the S (South) type. This study will facilitate synthesis of stereoregular methylphosphonate oligonucleotide analogues via the transesterification method.     

Effect of superalkali substituents on the strengths and properties of hydrogen and halogen bonds

Quantum chemical calculations have been performed for the complexes Li₃OCCX–Y (X?=?Cl, Br, H; Y?=?NH₃, H₂O, H₂S) and Li₃OCN–X′Y′ (X′Y′?=?ClF, BrCl, BrF, HF) to study the role of superalkalis in hydrogen and halogen bonds. The results show that the presence of an Li₃O cluster in a Lewis acid weakens its acidity, while its presence in a Lewis base enhances its basicity. Furthermore, the latter effect is more prominent than the former one, and the presence of an Na₃O cluster causes an even greater effect than Li₃O. The strengths of hydrogen and halogen bonds were analyzed using molecular electrostatic potentials. The contributions of superalkalis to the strength of hydrogen and halogen bonds were elucidated by analyzing differences in electron density.     

Two Distinct P2 Purinergic Receptors, P2Y and P2U, Are Coupled to Phospholipase C in Mouse Pineal Gland Tumor Cells

Abstract: We found that extracellular ATP can increase the intracellular Ca²⁺ concentration ([Ca²⁺]_i) in mouse pineal gland tumor (PGT-β) cells. Studies of the [Ca²⁺]_i rise using nucleotides and ATP analogues established the following potency order: ATP, adenosine 5′-O-(3-thiotriphosphate) ≥ UTP > 2-chloro-ATP > 3′-O-(4-benzoyl)benzoyl ATP, GTP ≥ 2-methylthio ATP, adenosine 5′-O-(2-thiodiphosphate) (ADPβS) > CTP. AMP, adenosine, α,β-methyleneadenosine 5′-triphosphate, β,γ-methyleneadenosine 5′-triphosphate, and UMP had little or no effect on the [Ca²⁺]_i rise. Raising the extracellular Mg²⁺ concentration to 10 mM decreases the ATP-and UTP-induced [Ca²⁺]_i rise, because the responses depend on the ATP^4? and UTP^4? concentrations, respectively. The P_2U purinoceptor-selective agonist UTP and the P_2Y purinoceptor-selective agonist ADPβS induce inositol 1,4,5-trisphosphate generation in a concentration-dependent manner with maximal effective concentrations of ～100 µM. In sequential stimulation, UTP and ADPβS do not interfere with each other in raising the [Ca²⁺]_i. Costimulation with UTP and ADPβS results in additive inositol 1,4,5-trisphosphate generation to a similar extent as is achieved with ATP alone. Pretreatment with pertussis toxin inhibits the action of UTP and ATP by maximally 45–55%, whereas it has no effect on the ADPβS response. Treatment with 1 µM phorbol 12-myristate 13-acetate inhibits the ADPβS-induced [Ca²⁺]_i rise more effectively than the ATP- and UTP-induced responses. These results suggest that P_2U and P_2Y purinoceptors coexist on PGT-β cells and that both receptors are linked to phospholipase C.     

RECONSTRUCTION OF AN APPARATUS OF NEOSTRACHANOGNATHUS TAHOENSIS FROM ORITATE,JAPAN AND SPECIES OF NEOSTRACHANOGNATHUS FROM OMAN

Abstract: The apparatus of an Early Triassic conodont Neostrachanognathus tahoensis Koike, 1998 from Oritate, Kumamoto Prefecture, Japan, and a species of Neostrachanognathus from Oman were reconstructed. On the basis of five natural assemblages from the Oritate area, the three‐dimensional apparatus model of N. tahoensis is interpreted as bilaterally symmetrical and composed of 14 elements consisting of pairs of P₁, P₂, P₃, S₁, S₂, S₃, and S₄ elements. The P₁ and P₂ elements are coniform elements, the P₃ elements are digyrate forms, and the S elements are bipennate ramiforms. The S elements are arranged rostrally in the apparatus and the pairs of the P₁, P₂, and P₃ elements are subvertically arranged caudally and ventrally to the S array. One of the natural assemblages was formed by rostrocaudal collapse of the apparatus on the sea floor, whereas the other assemblages indicate that conodont animals came to rest nearly parallel with the substrate prior to burial. A collection of isolated elements from Jabal Safra, Oman, includes a second species of Neostrachanognathus with a comparable apparatus.     

Temperature response and photoinhibition investigated by chlorophyll fluorescence measurements for four distinct species of dipterocarp trees

The effects of strong light in combination with elevated temperatures on the photosynthetic system were examined in 4 dipterocarp tree species with ecologically different habitats. The 4 dipterocarp tree species were: Shorea platyclados originated from upper dipterocarp forests, Shorea parvifolia– lowland and hill dipterocarp forests, Shorea assamica– lowland dipterocarp forests, and Dipterocarpus oblongifolius– riparian fringes. S. platyclados and D. oblongifolius have higher growth and survival rates in open sites than S. parvifolia and S. assamica. Tolerance of high temperature among the species was assessed by determining the critical temperatures (T_c) at which the minimal fluorescence (F_o) began to rise sharply. This was measured by exposing plants to an increasing temperature of about 1°C min^?1. The intrinsic thermotolerance of the thylakoid membrane appears to be the highest for D. oblongifolius (T_c=46.4°C), intermediate for S. platyclados (45.7°C), and lowest for S. parvifolia and S. assamica (45.2 and 45.3°C, respectively). The temperature‐dependent efficiency of PSII electron transport (ΔF/F′_m), photochemical quenching (q_P), and the efficiency of light capture of open PSII (F′_v/F′_m) were measured at the photosynthetic steady state at least 10 min after the light exposure (180 μmol m^?2 s^?1 PFD). Stable temperature responses of ΔF/F′_m and q_P were observed in S. platyclados and D. oblongifolius, while those in S. parvifolia and S. assamica were more temperature‐dependent and severely affected at 45°C. Little difference was observed in temperature‐dependent F′_v/F′_m among species. Photoinhibitory light exposure (1600 μmol m^?2 s^?1 PFD) for 2 h at 40°C had little effect on the recovery kinetics from photoinhibition of S. platyclados and D. oblongifolius compared with those at 35°C. In contrast, the recovery from photoinhibition was retarded in S. parvifolia and S. assamica. These findings suggest that even at 40°C, a temperature below T_c, an exposure to strong light exacerbated photoinhibition in S. parvifolia and S. assamica corresponding to the closure of PSII reaction centers, as indicated by the decrease in q_P at this temperature. Thus, S. platyclados and D. oblongifolius, which occur at uplands and riparian fringes with frequent disturbances, are suggested to have higher photosynthetic tolerance to elevated temperatures contributing to a circumvention of photoinhibition.     

Polysulfide‐Shuttle Control in Lithium‐Sulfur Batteries with a Chemically/Electrochemically Compatible NaSICON‐Type Solid Electrolyte

A NaSICON‐type Li⁺‐ion conductive membrane with a formula of Li_{1+ x} Y _x Zr_{2? x} (PO₄)₃ (LYZP) (x = 0–0.15) has been explored as a solid‐electrolyte/separator to suppress polysulfide‐crossover in lithium‐sulfur (Li‐S) batteries. The LYZP membrane with a reasonable Li⁺‐ion conductivity shows both favorable chemical compatibility with the lithium polysulfide species and exhibits good electrochemical stability under the operating conditions of the Li‐S batteries. Through an integration of the LYZP solid electrolyte with the liquid electrolyte, the hybrid Li‐S batteries show greatly enhanced cyclability in contrast to the conventional Li‐S batteries with the porous polymer (e.g., Celgard) separator. At a rate of C/5, the hybrid Li ||LYZP|| Li₂S₆ batteries developed in this study (with a Li‐metal anode, a liquid/LYZP hybrid electrolyte, and a dissolved lithium polysulfide cathode) delivers an initial discharge capacity of ≈1000 mA h g^?1 (based on the active sulfur material) and retains ≈90% of the initial capacity after 150 cycles with a low capacity fade‐rate of <0.07% per cycle.     

ATP-Activated Nonselective Cation Current in NG108-15 Cells

Abstract: ATP (1 mM) induced a biphasic increase in intracellular Ca²⁺ concentration ([Ca²⁺]_i), i.e., an initial transient increase decayed to a level of sustained increase, in NG108-15 cells. The transient increase was inhibited by a phospholipase C inhibitor, 1-[6-[[17β-3-methoxyestra-1,3,5(10)-trien-17-yl]amino]hexyl]-1H-pyrrole-2,5-dione (U73122), whereas the sustained increase was abolished by removal of external Ca²⁺. We examined the mechanism of the ATP-elicited sustained [Ca²⁺]_i increase using the fura-2 fluorescent method and the whole-cell patch clamp technique. ATP (1 mM) induced a membrane current with the reversal potential of 12.5 ± 0.8 mV (n = 10) in Tyrode external solution. The EC₅₀ of ATP was ～0.75 mM. The permeability ratio of various cations carrying this current was Na⁺ (defined as 1) > Li⁺ (0.92 ± 0.01; n = 5) > K⁺ (0.89 ± 0.03; n = 6) > Rb⁺ (0.55 ± 0.02; n = 6) > Cs⁺ (0.51 ± 0.01; n = 5) > Ca²⁺ (0.22 ± 0.03; n = 3) > N-methyl-d -glucamine (0.13 ± 0.01; n = 5), suggesting that ATP activated a nonselective cation current. The ATP-induced current was larger at lower concentrations of external Mg²⁺. ATP analogues that induced the current were 2-methylthio-ATP (2MeSATP), benzoylbenzoic-ATP, adenosine 5′-thiotriphosphate (ATPγS), and adenosine 5′-O-(2-thiodiphosphate), but not adenosine, ADP, α,β-methylene-ATP (AMPCPP), β,γ-methylene-ATP (AMPPCP), or UTP. Concomitant with the current data, 2MeSATP and ATPγS, but not AMPCPP or AMPPCP, increased the sustained [Ca²⁺]_i increase. We conclude that ATP activates a class of Ca²⁺-permeable nonselective cation channels via the P_2z receptor in NG108-15 cells.     

CycloSaligenyl Pronucleotides of 5-Iodo and 5-Trifluoromethyl-1-(2-deoxy-β-D-ribofuranosyl)-2,4-difluorobenzene Mimics of Thymidine: Synthesis and Evaluation of this Pronucleotide Monophosphate Delivery System for Compounds with Potential Anticancer Activity

Abstract

A group of unnatural 1-(2-deoxy-β-D-ribofuranosyl)-2,4-difluorobenzenes possessing a 5-I or 5-CF₃ substituent, that were originally designed as thymidine mimics, were coupled via their 5′-OH group to a cyclosaligenyl (cycloSal) ring system having a variety of C-3 substituents (Me, OMe, H). The 5′-O-cycloSal-pronucleotide concept was designed to effect a thymidine kinase-bypass, thereby providing a method for the intracellular delivery and generation of the 5′-O-monophosphate for nucleosides that are poorly phosphorylated. The 5′-O-cycloSal pronucleotide phosphotriesters synthesized in this study were obtained as a 1:1 mixture of two diastereomers that differ in configuration (S _P or R _P) at the asymmetric phosphorous center. The (S _P)- and (R _P)-diastereomers for the 5′-O-3-methylcycloSal- and 5′-O-3-methoxycycloSal derivatives of 1-(2-deoxy-β-D-ribofuranosyl)-2,4-difluoro-5-iodobenzene were separated by silica gel flash column chromatography. This class of cycloSal pronucleotide compounds generally exhibited weak cytotoxic activities in a MTT assay (CC₅₀ values in the 10^?3 to 10^?4 M range), against a number of cancer cell lines (143B, 143B-LTK, EMT-6, Hela, 293), except for cyclosaligenyl-5′-O-[1′-(2,4-difluoro-5-iodophenyl)-2′-deoxy-β-D-ribofuranosyl]phosphate that was more potent (CC₅₀ values in the 10^?5 to 10^?6 M range), than the reference drug 5-iodo-2′-deoxyuridine (IUDR) which showed CC₅₀ values in the 10^?3 to 10^?5 M range.     

Adenylyl-(5′, 2′)-adenosine 5′-Phosphate ((2′-5′) pA-A) in Crude Crystals of 5′-Adenylic Acid Isolated from Nuclease P1 (Penicillium Nuclease) Digest of Technical Grade Yeast RNA

Adenylyl (5′,2′)-adenosine 5′-phosphate ((2′-5′)pA-A) was detected in crude crystals of 5′-AMP prepared from Penicillium nuclease (nuclease P₁) digest of a technical grade yeast RNA. While (3′–5′)A-A was split by nuclease P₁, spleen phosphodiesterase, snake venom phosphodiesterase or alkali, (2′–5′)A-A was not split by a usual level of nuclease P₁ or spleen phosphodiesterase. Nuclease P₁ digests of 12 preparations of technical grade yeast RNA tested were confirmed to contain (2′–5′)pA-A. Its content was about 1 to 2% of the AMP component of each RNA preparation. As poly(A) was degraded completely by the Penicillium enzyme into 5′-AMP without formation of any appreciable amount of (2′–5′)pA-A, the technical grade RNA is supposed to contain 2–5′ phosphodiester linkages in addition to 3′–5′ major linkages.     

A Li2S‐TiS2‐Electrolyte Composite for Stable Li2S‐Based Lithium–Sulfur Batteries

Li₂S is a fully lithiated sulfur‐based cathode with a high theoretical capacity of 1166 mAh g^?1 that can be coupled with lithium‐free anodes to develop high‐energy‐density lithium–sulfur batteries. Although various approaches have been pursued to obtain a high‐performance Li₂S cathode, there are still formidable challenges with it (e.g., low conductivity, high overpotential, and irreversible polysulfide diffusion) and associated fabrication processes (e.g., insufficient Li₂S, excess electrolyte, and low reversible capacity), which have prevented the realization of high electrochemical utilization and stability. Here, a new cathode design composed of a homogeneous Li₂S‐TiS₂‐electrolyte composite that is prepared by a simple two‐step dry/wet‐mixing process is demonstrated, allowing the liquid electrolyte to wet the powder mixture consisting of insulating Li₂S and conductive TiS₂. The close‐contact, three‐phase boundary of this system improves the Li₂S‐activation efficiency and provides fast redox‐reaction kinetics, enabling the Li₂S‐TiS₂‐electrolyte cathode to attain stable cyclability at C/7 to C/3 rates, superior long‐term cyclability over 500 cycles, and promising high‐rate performance up to 1C rate. More importantly, this improved performance results from a cell design attaining a high Li₂S loading of 6 mg cm^?2, a high Li₂S content of 75 wt%, and a low electrolyte/Li₂S ratio of 6.     

PARTICIPATION OF EXTRACELLULAR NUCLEOTIDES IN THE WOUND RESPONSE OF DASYCLADUS VERMICULARIS AND ACETABULARIA ACETABULUM (DASYCLADALES,CHLOROPHYTA)1

As assayed by fluorescent reporter dyes, nitric oxide (NO) and H₂O₂, two downstream signaling agents induced by wounding in the alga Dasycladus vermicularis (Scop.) Krasser, can also be induced in unwounded Dasycladus cells by μM Adenosine 5′[γ‐thio]triphosphate (ATPγS) and Adenosine 5′‐[β‐thio]diphosphate (ADPβS), but not by Adenosine 5′‐O‐thiomonophosphate (AMPS). These nucleotide‐induced responses are blocked by pyridoxalphosphate‐6‐azophenyl‐2′,4′‐disulphonic acid (PPADS), an antagonist of animal purinoceptors, and by adenosine, a feed‐back inhibitor of extracellular nucleotide responses in animals. Similar nucleotide‐ and nucleotide‐antagonist responses were observed in Acetabularia acetabulum (L.) P. C. Silva. Significant levels of ATP released from Dasycladus cells were measured at wound sites by a sensitive luciferin‐luciferase assay. Additionally, the normal wound‐induced production of NO and H₂O₂ in Dasycladus can be blocked by pretreating the cells with PPADS. Our results indicate that nucleotides released from wounds can serve as a signal to trigger wound responses in algae, and that coordinated signaling between extracellular nucleotides and the NO pathway may have been established early during the evolution of plants.     

A Shell‐Shaped Carbon Architecture with High‐Loading Capability for Lithium Sulfide Cathodes

Lithium sulfide (Li₂S) is considered a highly attractive cathode for establishing high‐energy‐density rechargeable batteries, especially due to its high charge‐storage capacity and compatibility with lithium‐metal‐free anodes. Although various approaches have recently been pursued with Li₂S to obtain high performance, formidable challenges still remain with cell design (e.g., low Li₂S loading, insufficient Li₂S content, and an excess electrolyte) to realize high areal, gravimetric, and volumetric capacities. This study demonstrates a shell‐shaped carbon architecture for holding pure Li₂S, offering innovation in cell‐design parameters and gains in electrochemical characteristics. The Li₂S core–carbon shell electrode encapsulates the redox products within the conductive shell so as to facilitate facile accessibility to electrons and ions. The fast redox‐reaction kinetics enables the cells to attain the highest Li₂S loading of 8 mg cm^?2 and the lowest electrolyte/Li₂S ratio of 9/1, which is the best cell‐design specifications ever reported with Li₂S cathodes so far. Benefiting from the excellent cell‐design criterion, the core–shell cathodes exhibit stable cyclability from slow to fast cycle rates and, for the first time, simultaneously achieve superior performance metrics with areal, gravimetric, and volumetric capacities.     

Suppressing Li Dendrite Formation in Li2S‐P2S5 Solid Electrolyte by LiI Incorporation

Solid electrolytes have been considered as a promising approach for Li dendrite prevention because of their high mechanical strength and high Li transference number. However, recent reports indicate that Li dendrites also form in Li₂S‐P₂S₅ based sulfide electrolytes at current densities much lower than that in the conventional liquid electrolytes. The methods of suppressing dendrite formation in sulfide electrolytes have rarely been reported because the mechanism for the “unexpected” dendrite formation is unclear, limiting the successful utilization of high‐energy Li anode with these electrolytes. Herein, the authors demonstrate that the Li dendrite formation in Li₂S‐P₂S₅ glass can be effectively suppressed by tuning the composition of the solid electrolyte interphase (SEI) at the Li/electrolyte interface through incorporating LiI into the electrolyte. This approach introduces high ionic conductivity but electronic insulation of LiI in the SEI, and more importantly, improves the mobility of Li atoms, promoting the Li depositon at the interface and thus suppresses dendrite growth. It is shown that the critical current density is improved significantly after incorporating LiI into Li₂S‐P₂S₅ glass, reaching 3.90 mA cm^?2 at 100 °C after adding 30 mol% LiI. Stable cycling of the Li‐Li cells for 200 h is also achieved at 1.50 mA cm^?2 at 100 °C.     

Solvent‐Mediated Li2S Electrodeposition: A Critical Manipulator in Lithium–Sulfur Batteries

Controlling electrochemical deposition of lithium sulfide (Li₂S) is a major challenge in lithium–sulfur batteries as premature Li₂S passivation leads to low sulfur utilization and low rate capability. In this work, the solvent's roles in controlling solid Li₂S deposition are revealed, and quantitative solvent‐mediated Li₂S growth models as guides to solvent selection are developed. It is shown that Li₂S electrodeposition is controlled by electrode kinetics, Li₂S solubility, and the diffusion of polysulfide/Li₂S, which is dictated by solvent's donicity, polarity, and viscosity, respectively. These solvent‐controlled properties are essential factors pertaining to the sulfur utilization, energy efficiency and reversibility of lithium–sulfur batteries. It is further demonstrated that the solvent selection criteria developed in this study are effective in guiding the search for new and more effective electrolytes, providing effective screening and design criteria for computational and experimental electrolyte development for lithium–sulfur batteries.     

Tethered Molecular Sorbents: Enabling Metal‐Sulfur Battery Cathodes

A rechargeable battery that uses sulfur at the cathode and a metal (e.g., Li, Na, Mg, or Al) at the anode provides perhaps the most promising path to a solid‐state, rechargeable electrochemical storage device capable of high charge storage capacity. It is understood that solubilization in the electrolyte and loss of sulfur in the form of long‐chain lithium polysulfides (Li₂S_x, 2 < x < 8) has hindered development of the most studied of these devices, the rechargeable Li‐S battery. Beginning with density‐functional calculations of the structure and interactions of a generic lithium polysulfide species with nitrile containing molecules, it is shown that it is possible to design nitrile‐rich molecular sorbents that anchor to other components in a sulfur cathode and which exert high‐enough binding affinity to Li₂S_x to limit its loss to the electrolyte. It is found that sorbents based on amines and imidazolium chloride present barriers to dissolution of long‐chain Li₂S_x and that introduction of as little as 2 wt% of these molecules to a physical sulfur‐carbon blend leads to Li‐S battery cathodes that exhibit stable long‐term cycling behaviors at high and low charge/discharge rates.     

A Lithium–Sulfur Cell Based on Reversible Lithium Deposition from a Li2S Cathode Host onto a Hostless‐Anode Substrate

The development of lithium–sulfur batteries necessitates a thorough understanding of the lithium‐deposition process. A novel full‐cell configuration comprising an Li₂S cathode and a bare copper foil on the anode side is presented here. The absence of excess lithium allows for the realization of a truly lithium‐limited Li–S battery, which operates by reversible plating and stripping of lithium on the hostless‐anode substrate (copper foil). Its performance is closely tied to the efficiency of lithium deposition, generating valuable insights on the role and dynamic behavior of lithium anode. The Li₂S full cell shows reasonable capacity retention with a Coulombic efficiency of 96% over 100 cycles, which is a tremendous improvement over that of a similar lithium‐plating‐based full cell with LiFePO₄ cathodes. The exceptional robustness of the Li₂S system is attributed to an intrinsic stabilization of the lithium‐deposition process, which is mediated by polysulfide intermediates that form protective Li₂S and Li₂S₂ regions on the deposited lithium. Combined with the large improvements in energy density and safety by the elimination of a metallic lithium anode, the stability and electrochemical performance of the lithium‐plating‐based Li₂S full cell establish it as an important trajectory for Li–S battery research, focusing on practical realization of reversible lithium anodes.     

EVALUATION OF COMPETITIVE ABILITY OF STAURASTRUM LUETKEMUELLERII (CHLOROPHYCEAE) AND MICROCYSTIS AERUGINOSA (CYANOPHYCEAE) UNDER P LIMITATION1

The desmid Staurastrum luetkemuellerii Donat et Ruttner and the cyanobacterium Microcystis aeruginosa Kütz. showed pronounced differences in chemical composition and ability to maintain P fluxes. The cellular P:C ratio (Q_p) and the surplus P:C ratio (Q_sp) were higher in M. aeruginosa, indicating a lower yield of biomass C per unit of P. The subsistence quota (Q_p) was 1.85 μg P·mg C^?1in S. luetkemuellerii and 6.09 μg P·mg C^?1in M. aeruginosa, whereas the respective Q_p of P saturnted organisms (Q_s) were 43 and 63 μg P·mg C^?1. These stores could support four divisions in S. luetkemuellerii and three divisions in M. aeruginosa, which suggests that the former exhibited highest storage capacity (Q_s/Q₀). M. aeruginosa showed a tenfold higher activity of alkaline phosphatase than S. luetkemuellerii when P starved. The optimum N:P ratio (by weight) was 5 in S. luetkemuellerii and 7 in M. aeruginosa. The initial uptake of P_i pulses in the organisms was not inhibited by rapid (<1 h) internal feedback mechanisms and the short term uptake rote could be expressed solely as a function of ambient P_i. The maximum cellular C-based uptake rate (V_m) in P starved M. aeruginosa was up to 50 times higher than that of S. luetkemuellerii. It decreased with increasing growth rate (P status) in the former species and remained fairly constant in the latter. The corresponding cellular P-based value (U_m= V_m/Q_p) decreased with growth rate in both species and was about 10 times higher in P started M. aeruginosa than in S. luetkemuellerii. The average half saturation constant for uptake (K_m) was equal for both species (22 μg P·L^?1) and varied with the P status. S. luetkemuellerii exhibited shifts in the uptake rate of P_i that were characterized by increased affinity (U^m/K^m) at low P_i, concentrations (<4 μg P·L^?1) compared to that at higher concentrations. The species thus was well adapted to uptake at low ambient P_i, but M. aeruginosa was superior in P_i uptake under steady state and transient conditions when the growth rate was lower than 0.75 d^?1. Moreover, M. aeruginosa was favored by pulsed addition of P_i. M. aeruginosa relpased P_i at a higher rate than S. luetkemuellerii. Leakage of P_i from the cells caused C-shaped μ vs. P_i curves. Therefore, no unique K_s for growth could be estimated. The maximum growth rate (μ_m) (23° C) was 0.94 d^?1for S. luetkemuellerii and 0.81 d^?1for M. aeruginosa. The steady state concentration of P_i (P*) was lower in M. aeruginosa than in S. luetkemuellerii at medium growth rates. The concentration of P_i at which the uptake and release of P_i was equal (P_c was, however, lower in S. luetkemuellerii.     

An Effective Lithium Sulfide Encapsulation Strategy for Stable Lithium–Sulfur Batteries

With a high theoretical capacity of 1162 mA h g^?1, Li₂S is a promising cathode that can couple with silicon, tin, or graphite anodes for next‐generation energy storage devices. Unfortunately, Li₂S is highly insulating, exhibits large charge overpotential, and suffers from active‐material loss as soluble polysulfides during battery cycling. To date, low‐cost, scalable synthesis of an electrochemically active Li₂S cathode remains a challenge. This work demonstrates that the low conductivity and material loss issues associated with Li₂S cathodes can be overcome by forming a stable, conductive encapsulation layer at the surface of the Li₂S bulk particles through in situ surface reactions between Li₂S and electrolyte additives containing transition‐metal salts. It is identified that the electronic band structure in the valence band region of the thus‐generated encapsulation layers, consisting largely of transition‐metal sulfides, determines the initial charging resistance of Li₂S. Furthermore, among the transition metals tested, the encapsulation layer formed with an addition of 10 wt% manganese (II) acetylacetonate salt proved to be robust within the cycling window, which is attributed to the chemically generated MnS surface species. This work provides an effective strategy to use micrometer‐sized Li₂S directly as a cathode material and opens up new prospects to tune the surface properties of electrode materials for energy‐storage applications.     

A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.