DNA sequence recognition by Hoechst 33258 conjugates of hairpin pyrrole/imidazole polyamides

A series of hairpin pyrrole/imidazole polyamides linked to a Hoechst 33258 (Ht) analogue (5-7) were synthesized on solid-phase by adopting an Fmoc technique using a series of PyBOP/HOBt mediated coupling reactions. The dsDNA binding properties of Ht-polyamides 5-7 were determined by thermal denaturation experiments. Hairpin Ht-polyamides 5-7 bound to dsDNA sequences 16 and 18 show DeltaTm values that are 14-18 degrees higher than linear Ht-polyamides bound to the same sequences. All three Ht-polyamides were found to be selective for their 9-bp match dsDNA sequences, supporting a relative stronger interaction of an Im/Py anti-parallel dimer with an appropriately positioned G/Cbp rather than sequences containing only A/Tbps. In addition, Ht-polyamides 5 and 7 showed a 20-fold preference for a properly placed G/Cbp over a C/Gbp, while 6 showed a 10-fold preference.     

Specific targeting of insect and vertebrate telomeres with pyrrole and imidazole polyamides.

DNA minor groove-binding compounds (polyamides) that target insect and vertebrate telomeric repeats with high specificity were synthesized. Base pair recognition of these polyamides is based on the presence of the heterocyclic amino acids pyrrole and imidazole. One compound (TH52B) interacts uniquely and with excellent specificity (K(d) = 0.12 nM) with two consecutive insect-type telomeric repeats (TTAGG). A related compound, TH59, displays high specificity (K(d) = 0.5 nM) for tandem vertebrate (TTAGGG) and insect telomeric repeats. The high affinity and specificity of these compounds were achieved by bidentate binding of two flexibly linked DNA-binding moieties. Epifluorescence microscopy studies show that fluorescent derivatives of TH52B and TH59 stain insect or vertebrate telomeres of chromosomes and nuclei sharply. Importantly, the telomere-specific polyamide signals of HeLa chromosomes co-localize with the immunofluorescence signals of the telomere-binding protein TRF1. Our results demonstrate that telomere-specific compounds allow rapid estimation of relative telomere length. The insect-specific compound TH52 was shown to be incorporated rapidly into growing Sf9 cells, underlining the potential of these compounds for telomere biology and possibly human medicine.     

Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔT_M experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings.     

Novel diamino imidazole and pyrrole-containing polyamides: Synthesis and DNA binding studies of mono- and diamino-phenyl-ImPy*Im polyamides designed to target 5'-ACGCGT-3'

Pyrrole- and imidazole-containing polyamides are widely investigated as DNA sequence selective binding agents that have potential use as gene control agents. The key challenges that must be overcome to realize this goal is the development of polyamides with low molar mass so the molecules can readily diffuse into cells and concentrate in the nucleus. In addition, the molecules must have appreciable water solubility, bind DNA sequence specifically, and with high affinity. It is on this basis that the orthogonally positioned diamino/dicationic polyamide Ph-ImPy*Im 5 was designed to target the sequence 5'-ACGCGT-3'. Py* denotes the pyrrole unit that contains a N-substituted aminopropyl pendant group. The DNA binding properties of diamino polyamide 5 were determined using a number of techniques including CD, ΔT(M), DNase I footprinting, SPR and ITC studies. The effects of the second amino moiety in Py* on DNA binding affinity over its monoamino counterpart Ph-ImPyIm 3 were assessed by conducting DNA binding studies of 3 in parallel with 5. The results confirmed the minor groove binding and selectivity of both polyamides for the cognate sequence 5'-ACGCGT-3'. The diamino/dicationic polyamide 5 showed enhanced binding affinity and higher solubility in aqueous media over its monoamino/monocationic counterpart Ph-ImPyIm 3. The binding constant of 5, determined from SPR studies, was found to be 1.5 × 10(7)M(-1), which is ～3 times higher than that for its monoamino analog 3 (4.8 × 10(6)M(-1)). The affinity of 5 is now approaching that of the parent compound f-ImPyIm 1 and its diamino equivalent 4. The advantages of the design of diamino polyamide 5 over 1 and 4 are its sequence specificity and the ease of synthesis compared to the N-terminus pyrrole analog 2.     

Binding of bis-linked netropsin derivatives in the parallel-stranded hairpin form to DNA

Cis-diammine Pt(II)- bridged bis-netropsin and oligomethylene-bridged bis-netropsin in which two monomers are linked in a tail-to-tail manner bind to the DNA oligomer with the sequence 5'-CCTATATCC-3' in a parallel-stranded hairpin form with a stoichiometry 1:1. The difference circular dichroism (CD) spectra characteristic of binding of these ligands in the hairpin form are similar. They differ from CD patterns obtained for binding to the same duplex of another bis-netropsin in which two netropsin moieties were linked in a head-to-tail manner. This reflects the fact that tail-to-tail and head-to-tail bis-netropsins use parallel and antiparallel side-by-side motifs, respectively, for binding to DNA in the hairpin forms. The binding affinity of cis-diammine Pt(II)-bridged bis-netropsin in the hairpin form to DNA oligomers with nucleotide sequences 5'-CCTATATCC-3' (I), 5'-CCTTAATCC-3' (II), 5'-CCTTATTCC-3' (III), 5'-CCTTTTTCC-3' (IV) and 5'-CCAATTTCC-3' (V) decreases in the order I = II > III > IV > V . The binding of oligomethylene-bridged bis-netropsin in the hairpin form follows a similar hierarchy. An opposite order of sequence preferences is observed for partially bonded monodentate binding mode of the synthetic ligand.     

Sequence selective recognition of DNA by hairpin conjugates of a racemic seco-cyclopropaneindoline-2-benzofurancarboxamide and polyamides

Conjugates of racemic seco-cyclopropaneindoline-2-benzofurancarboxamide (CI-Bf) and four diamides (ImIm 1, ImPy 2, PyIm 3, and PyPy 4, where Py is pyrrole, and Im is imidazole), linked by a gamma-aminobutyrate group were synthesized. In addition to alkylating at adenine-N3 positions within an A(5) sequence, the imidazole-containing compounds 1 and 2 were found to also alkylate purine-N3 positions within a sequence 3'-GGGGGGA(888)CTGCTC(894)-5'. A model for the binding of hairpin conjugates 1 and 2 with the 3'-GACT-5' sequence is proposed.     

Sequence specific recognition of DNA by tailor-made hairpin conjugates of achiral seco-cyclopropaneindoline-2-benzofurancarboxamide and pyrrole-imidazole polyamides

Hairpin conjugates of achiral seco-cyclopropaneindoline-2-benzofurancarboxamide (achiral seco-CI-Bf) and three diamides (ImPy 1, PyIm 2, and PyPy 3, where Py is pyrrole, and Im is imidazole), linked by a gamma-aminobutyrate group, were synthesized. The sequence-specific covalent alkylation of the achiral CI moiety with adenine-N3 in the minor groove was ascertained by thermally induced DNA cleavage experiments. The results provide evidence that hairpin conjugates of achiral seco-CI-Bf-gamma-polyamides could be tailored to target specific DNA sequences according to a set of general rules: the achiral CI moiety selectively reacts with adenine-N3, a stacked pair of imidazole/benzofuran prefers a G/C base pair, and a pyrrole/benzofuran prefers an A/T or T/A base pair. Models for the binding of hairpin conjugates 1-3 with sequences 5'-TCA(888)G-3', 5'-CAA(857)C-3', and 5'-TTA(843)C-3' are proposed.     

On the relations between error rates in DNA replication and elementary chemical rate constants

A general treatment of the so-called peelback process is presented, where the final rates of errors in a simple model of DNA replication are derived from elementary chemical rate constants for incorporation or removal of correct or incorrect bases, in cases where these constants depend or not on the identity of the preceding base. It is shown that evidences regarding this dependence, for addition as well as for excision or pyrophosphorolysis, can be obtained from experimental determinations of the rate of appearance of various kinds of incorrect doublets in the final material and that these implications hold not only in the simple model case of a homopolynucleotide with a mixture of correct and incorrect substrates, but also in the real case of the four-bases DNA replication with the possibility of incorporation of incorrect bases instead of the correct ones in specific doublets. The connections between the various classes of parameters involved in a peelback process (instantaneous concentrations and lifetimes in final position, probabilities for ultimate fates, final contents of specific bases or doublets or triplets, etc.) are given in the Introduction.     

The elution profile of immobilized liposome chromatography: determination of association and dissociation rate constants

The interaction of lipophilic cations, tetraphenylphosphonium and triphenylphosphonium homologues with liposomes was investigated using immobilized liposome chromatography (ILC). Large unilamellar liposomes with a mean diameter of 100 nm were stably immobilized in chromatographic gel beads by avidin-biotin. The distribution coefficient calculated from (Ve-V0)/Vs (Ve, retention volume; V0, the void volume; Vs, the stationary phase volume) was found to be independent of flow rate, injection amount and gel bed volume, which is consistent with chromatograph theory. The relationship between the bandwidth and solvent flow rate did not follow band-broadening theories reported thus far. We hypothesized that the solvent might be forced to produce large eddies, spirals or turbulent flow due to the presence of liposomes fixed in the gel. Therefore, we developed a new theory for ILC elution: The column is composed of a number of thin disks containing liposomes and solution, and within each disk the solution is well mixed. This theory accounts for our results, and we were able to use it to estimate the rate constants of association and dissociation of the phosphonium to/from liposomes.     

Interaction between hydroxystilbamidine and DNA. I. Binding isotherms and thermodynamics of the association.

Isotherms describing the binding of hydroxystilbamidine to DNA and polydeoxyribonucleotides were obtained by means of sedimentation or dialysis experiments and fluorescence measurements, over a large range of ionic strengths, temperatures and base compositions. Two different sets of binding sites are necessary to explain the shapes of the isotherms. The first one is characterized by a higher binding constant, a topological specificity for the A-T pair, exclusion of four base pairs per bound dye molecule, the involvement of two ion-pairs, an almost purely entropic free energy of binding and a large enhancement of the blue fluorescence (450 nm) when the site corresponds to three adjacent A-T pairs. The latter does not present any specificity nor enhancement of fluorescence and only one ion-pair is formed. From the geometry of the dye and its selective binding to a double stranded structure, the hydroxystilbamidine molecule in the first set of sites is likely to be situated in the small groove astride the two complementary strands and slightly distorting the helical structure. The angle of the dye axis with the helix axis has a value close to 47 degrees. No definite explanation could be given for the specific binding of hydroxystilbamidine but the phenolic hydroxyl group is likely to play a major role. The hydroxystilbamidine molecule can be considered as a useful tool for checking the accessibility of the small groove.     

Determination of association and dissociation rate constants for bilirubin--bovine serum albumin.

The association rate constant for the binding of bilirubin to bovine serum albumin has been determined in a continuous-flow experiment. The value obtained is 0.9 x 10⁶m^?1S^?1. Furthermore the dissociation rate constant is determined from the rate of the peroxidase-catalyzed oxidation of bilirubin in a bilirubin-albumin solution. This figure is 3.1 × 10^?2s ¹. Calculation of the apparent binding equilibrium constant from the two rate constants gives 2.9 x 10⁷m^?1. The above mentioned peroxidase oxidation has also been used for a direct estimation of the binding equilibrium constant giving 2.7 × 10⁷m^?1. All experiments are carried out at 36 °C and pH 7.4.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

The relationship of intercompartmental excitation transfer rate constants to those of an underlying physical model

In studies on photosynthetic systems it is common practice to interpret the results of time-resolved fluorescence experiments on the basis of compartmental, or target, models. Each compartment represents a group of molecules with similar fluorescence characteristics. In cases of practical interest, the members of each compartment are spatially contiguous and make up part of an overall energy-transferring system. Since a rate constant describing the overall transfer between compartments is not that of any pair of molecules in the system, this question naturally rises: what do we learn about the microscopic structure from these data? In this note we introduce ‘compartment melting’, a smooth mathematical connection between the compartmental and microscopic levels. We then show, on the basis of model calculations on finite lattices in one, two, and three dimensions, that average microscopic rates at the interfaces between compartments may be estimated from observed intercompartmental rates. The estimate involves a modest number of structural assumptions about the system. As examples of the method, which is applicable mainly to systems containing homogeneous pigment pools, some recent chlorophyll-protein antenna studies are analyzed.     

DNA minor groove electrostatic potential: influence of sequence-specific transitions of the torsion angle gamma and deoxyribose conformations

The structural adjustments of the sugar-phosphate DNA backbone (switching of the γ angle (O5′–C5′–C4′–C3′) from canonical to alternative conformations and/or C2′-endo → C3′-endo transition of deoxyribose) lead to the sequence-specific changes in accessible surface area of both polar and non-polar atoms of the grooves and the polar/hydrophobic profile of the latter ones. The distribution of the minor groove electrostatic potential is likely to be changing as a result of such conformational rearrangements in sugar-phosphate DNA backbone. Our analysis of the crystal structures of the short free DNA fragments and calculation of their electrostatic potentials allowed us to determine: (1) the number of classical and alternative γ angle conformations in the free B-DNA; (2) changes in the minor groove electrostatic potential, depending on the conformation of the sugar-phosphate DNA backbone; (3) the effect of the DNA sequence on the minor groove electrostatic potential. We have demonstrated that the structural adjustments of the DNA double helix (the conformations of the sugar-phosphate backbone and the minor groove dimensions) induce changes in the distribution of the minor groove electrostatic potential and are sequence-specific. Therefore, these features of the minor groove sizes and distribution of minor groove electrostatic potential can be used as a signal for recognition of the target DNA sequence by protein in the implementation of the indirect readout mechanism.     

Length dependence of rate constants for end-to-end association and dissociation of equilibrium linear aggregates

A semi-quantitative analysis is given of the length dependence of the rate constant for association (annealing) of two long linear aggregates in solution. The equilibrium constant for this process, or its inverse (fragmentation or dissociation), is relatively easy to formulate from appropriate partition functions. From these two ingredients, the length dependence of the rate constant for spontaneous fragmentation can be deduced. Numerical examples are included.     

Nonfixed relationship of the Michaelis constant and maximum velocity with their corresponding rate constants

The Michaelis constant (K(m)) and V(mas) (E0k(cat)) values for two mutant sets of enzymes were studied from the viewpoint of their definition in a rapid equilibrium reaction model and in a steady state reaction model. The "AMP set enzyme" had a mutation at the AMP-binding site (Y95F, V67I, and V67I/L76V), and the "ATP set enzyme" had a mutation at a possible ATP-binding region (Y32F, Y34F, and Y32A/Y34A). Reaction rate constants obtained using steady state model analysis explained discrepancies found by the rapid equilibrium model analysis. (i) The unchanged number of bound AMPs for Y95F and the wild type despite the markedly increased K(m) values for AMP of the AMP set of enzymes was explained by alteration of the rate constants of the AMP step (k(+2), k(-2)) to retain the ratio k(+2)/k(-2). (ii) A 100 times weakened selectivity of ATP for Y34F in contrast to no marked changes in K(m) values for both ATP and AMP for the ATP set of enzymes was explained by the alteration of the rate constants of the ATP steps. A similar alteration of the K(m) and k(cat) values of these enzymes resulted from distinctive alterations of their rate constants. The pattern of alteration was highly suggestive. The most interesting finding was that the rate constants that decided the K(m) and k(cat) values were replaced by the mutation, and the simple relationships between K(m), k(cat), and the rate constants of K(m)1 = k(+1)/k(-1) and k(cat) = k(f) were not valid. The nature of the K(m) and k(cat) alterations was discussed.     

Binding of hexabrachions to heparin and DNA

Hexabrachions are extracellular proteins expressed in certain tissues and at specific points in development. cDNA sequencing has revealed that they contain a region of repeats that are similar to the type III homology units of fibronectin. The corresponding region of fibronectin contains heparin- and DNA-binding domains. We have compared the heparin and DNA binding of hexabrachion secreted by the human glioblastoma cell line U87MG to that of fibronectin. Both proteins bound to heparin-agarose in low salt (0.05 M NaCl) buffers. Using linear salt gradients, hexabrachion was eluted from heparin prior to fibronectin. The addition of 5 mM CaCl2 decreased the affinity of both proteins for heparin, but it had a greater effect upon the binding of fibronectin. Free heparin but not chondroitin sulfate inhibited the binding of both proteins to heparin-agarose. In addition, hexabrachion bound to DNA as fibronectin does, and this binding could be inhibited by heparin but not by chondroitin sulfate. Unlike fibronectin, hexabrachion did not bind to gelatin when samples containing both proteins were passed over gelatin-agarose, also indicating that there was no interaction between hexabrachion and fibronectin. In contrast to hexabrachion isolated from brain, the protein secreted by the human glioblastoma cell line U87MG does not bear the HNK-1 epitope which is on a carbohydrate that can mediate interactions between cells.