Saguinus geoffroyi as a host for Plasmodium vivax

A monkey-adapted strain of Plasmodium vivax (Achiote) was transferred by trophozoites through 11 serial passages in Saguinus geoffroyi (Titi marmoset). Patent infections developed in both normal (23 of 24) and splenectomized (8 of 9) marmosets. The infections in the altered animals were of greater severity than in the intact subjects as indicated by patent periods ($\text{x}\text{?}\text{= 87}\text{vs}\text{61}\text{days}$) and maximum parasitemias ($\text{x}\text{?}\text{= 35,018}\text{vs}\text{16,218}\text{per mm}{}^3$).Relapses were recorded in 13 of 14 unaltered and 4 of 4 splenectomized animals that survived the primary attack. As evidence for acquired immunity, the mean maximum parasitemias during relapse in the normal animals were $\text{1}\text{8}$ of the values during the primary attack; patent periods were shorter than those in the initial infection. There was also some indication of an acquired immunity in the splenectomized group of animals. However, one splenectomized marmoset experienced a patent period of 325 days during the first relapse.There was considerable variation of infection parameters among the animals in each group.     

Aureobasidium pullulans metabolism of prostaglandins of the A-type

$\text{Aureobasidium pullulans}$, originally introduced as an inadvertent contaminant in solutions used for evaluating the stability of prostaglandins, proved to lead to the rapid disappearance of the cyclopentenone unit of PGA₂ (as monitored by circular dichroic spectroscopy). The cyclopentenone unit is converted, in various metabolites, to a 9-keto, 9α or 9β-hydroxy group lacking the ring unsaturation. The major EtoAc-soluble 9-hydroxy metabolite (Compound-I) was shown to be 9α, 15α-dihydroxy-2,3,4,5-tetranor-13-$\text{trans}$-prostenoic acid. Similar tetranor 9-hydroxy metabolites with one additional degree of unsaturation, and with a 9β-hydroxy group, also occur but these have not been fully characterized. Only two of the wide range of 9-keto metabolites are fully characterized by mass spectral (MS) data: 9,15-oxo-2,3,4,5-tetranorprostanoic acid and 9,15-oxo-2,3,4,5-tetranor-13-$\text{trans}$-prostenoic acid. The water soluble metabolites have not been characterized further.The fully characterized metabolites together with MS data from mixtures of minor metabolites indicate that $\text{A. pullulans}$ can perform the following transformations: β-oxidation, dehydrogenation at C-15, reduction of the enone carbon-carbon double bonds (both Δ^10,11 and Δ^13,14), reduction of the 9-ketone, and possibly migration of the cyclopentyl double bond (Δ^10,11 → Δ^11,12). $\text{A. pullulans}$ metabolizes 15-epimeric PGA₂ equally readily with the production of similar products. PGA₁ affords less 9-keto metabolites with compound I constituting 33% of the product by HPLC analysis. $\text{A. pullulans}$ displays some enantioselectivity, PGA₂ and 15-epi-PGA₂ are each metabolized more rapidly than their enantiomers. Other prostaglandins appear to be less readily metabolized.     

The structure of a repressor: crystallographic data for the Cro regulatory protein of bacteriophage lambda.

Crystals of the bacteriophage λ Cro repressor protein that are suitable for X-ray diffraction studies have been obtained. Preliminary crystallographic analysis reveals that the space group is R32, the cell dimensions in the hexagonal system are $\text{a = b = 91·9}\text{A}\text{?}\text{, c = 268·9}\text{A}\text{?}$, and there are three dimers per asymmetric unit.     

Effects of lighting programs on onset of the ovulatory season in mares

Using 240 pony mares, lighting regimens were tested for their efficiency in hastening the onset of the ovulatory season. The mean number of days from January 1 to first ovulation was used as the end point. No advantage was gained by beginning a fixed lighting regimen ($\text{15.5L}\text{8.5D}$, hours light/hours dark) November 1 (66 ±8) versus December 1 (65 ±9), but beginning on January 1 was less efficient (98 ±8; controls, 132 ±5; P<0.05). In another experiment, daily three-hour interruptions of either the light phase (67 ±10) or the dark phase (71 ±11) did not significantly retard the effectiveness of a fixed regimen of $\text{15L}\text{9D}$ (54 ±5; controls, 142 ±6). A $\text{15L}\text{9D}$ regimen every other day (natural day length on alternate days) resulted in an interval (85 ±7) that was shorter (P<0.05) than for the controls and longer (not significant) than for the daily $\text{15L}\text{9D}$ regimen. When used with natural day length, a one-hour pulse of light in the evening (15 hours after sunrise) was not effective (141 ±6); a one-hour pulse in the morning 9.5 hours after sunset) was only partially effective (117 ±6). In another experiment, the interval was reduced (P<0.05) in a group with one hour of light fixed at 4:00 a.m. with natural day length (85 ±8; $\text{15L}\text{9D}$, 75 ±7; controls, 126 ±9). Results indicated that a fixed one-hour pulse of light at 4 a.m., used with natural day length, may provide an acceptable level of stimulation.     

Behavioral comparisons of the stereoisomers of tetrahydrocannabinols

The potencies of (?)-$\text{trans}$-Δ⁹-THC, (+)-$\text{trans}$-Δ⁹-THC, (+)-$\text{cis}$-Δ⁹-THC, (?)-$\text{trans}$-Δ⁸-THC and (+)-$\text{trans}$-Δ⁸-THC were compared in several different species. (?)-$\text{trans}$-Δ⁹-THC was 100 times more potent than (+)-$\text{trans}$-Δ⁹-THC in depressing schedule-controlled responding in monkeys. The (+)-$\text{trans}$ isomers were less effective than their corresponding (?)-$\text{trans}$ isomers in the dog static-ataxia test, but potency ratios could not be determined due to a lack of dose-responsiveness of the (+)-$\text{trans}$ isomers. However, it appeared that their potency differed by at least ten fold. The potency of (+)-$\text{cis}$-Δ⁹-THC in the dog static-ataxia test was comparable to that of (+)-$\text{trans}$-Δ⁹-THC. The hypothermia in mice produced by the (?) isomers of $\text{trans}$-Δ⁹-THC and $\text{trans}$-Δ⁸-THC were 9.1 and 30.4 times greater than that produced by their respective (+)-isomers. Also, the potency ratio of the (+)- and (?)-$\text{trans}$-Δ⁹-THC was 5.6 as measured by depression of spontaneous activity in mice. The magnitude of the potency ratios of the THC stereo-isomers is dependent upon the species and the pharmacological test used.     

Effect of protected protein supplements on some testicular traits in Brahman cross bulls

Differences in a number of testicular traits were examined in 12 Brahman cross (F₂ generation $\text{1}\text{2}$ and $\text{3}\text{4}$ BX) bulls fed either poor-quality native pasture (NP) hay or NP hay with a protected protein supplement. Supplementation for 60 days significantly (P < 0.05) increased roughage dry matter intake (7.7 $\text{v}$ 5.6 kg/head/day), enabling maintenance of liveweight, whereas control animals lost 40 kg. There were significant (P < 0.05) decreases in scrotal circumference (1.5cm) and testicular consistency (0.8 score) in the control group, in which testes weights at slaughter were significantly (P < 0.05) less (373 g $\text{v}$ 459 g), with corresponding lower epididymal weights (37.4 g $\text{v}$ 43.5 g). Estimates of daily sperm production per gram (DSPG) were similar for both groups, and testis daily sperm production (DSP) was somewhat but not significantly (P>0.05) lower in the control group (4.3 × 10⁹$\text{v}$ 6.0 × 10⁹) as a result of lower testis weights. Total epididymal sperm storage capacity was also lower in control bulls (17.2 × 10⁹$\text{v}$ 27.0 × 10⁹), but only significantly (P < 0.05) in relation to cauda sperm reserves (8.5 × 10⁹$\text{v}$ 13.6 × 10⁹). Luteinizing hormone (LH) and testosterone responses to gonadotrophin releasing hormone (GnRH) treatment were similar for both groups, although LH responses to GnRH were greater in $\text{1}\text{2}$ BX than in $\text{3}\text{4}$ BX bulls.     

Light scattering and quenching of 9-aminoacridine fluorescence as indicators of the phosphorylation state of the adenylate system in intact spinach chloroplasts

Upon illumination of suspensions of intact chloroplasts, fluorescence of 9-aminoacridine was quenched, light scattering was increased, chlorophyll fluorescence was decreased after an initial increase, and chloroplast $\text{ATP}\text{ADP}$ ratios were increased. The response of 9-aminoacridine fluorescence quenching and light scattering to light intensity, anaerobiosis and inhibition of electron transport by DCMU was similar to that shown by chloroplast $\text{ATP}\text{ADP}$ ratios. It is discussed under what conditions 9-aminoacridine fluorescence quenching or light scattering can be used to monitor changes in the phosphorylation state of the chloroplast adenylate system.     

Structure of a ribosomal 5S RNA from a mushroom, Coprinus cinereus

The nucleotide sequence of the 5S rRNA from a mushroom, $\text{Coprinus cinereus}$, was determined to be: pAUCCACGGCCAUACGACUCUGAAAGCACCGCACCGCAUCCCGUCCGAUCUGCGCAGUUAACCAGAGUGCCGCUCAGUUAGUACCACGGUGGGGGACCACGCGGGAAUCCUGGGUGCUGUGGUU. This sequence is consistent with current models for the secondary structure of 5S RNAs and indicates a very high degree of sequence conservation among the most highly evolved fungi. Sequence heterogeneity was not evident in this fungus suggesting that the more highly evolved fungi may not contain the dispersed pattern of 5S rRNA genes which have been observed in intermediate fungi such as $\text{Neurospora}$ (Selker, E.U., and Yanofsky, C. (1981) Cell $\text{24}$, 819–828.)     

Aliphatic hydroxylation by highly purified liver microsomal cytochrome P-450. Evidence for a carbon radical intermediate

The oxidation of norbornane by a reconstituted liver cytochrome P-450 system affords $\text{exo}$- and $\text{endo}$-2-norborneol in a ratio of 3.4:1. The ratio of these products was found to be 0.76:1 when $\text{exo,exo,exo,exo}$-2,3,5,6-tetradueteronorbornane was oxidized. Analysis of the mass spectra of the products from the deuterated hydrocarbon showed that 25% of the $\text{exo}$-norborneol contained four deuterium atoms whereas 9% of the $\text{endo}$-norborneol contained three deuterium atoms. These results, which indicate a very large isotope effect ($\text{k}{}_{\mathrm{H}}\text{k}{}_{\mathrm{D}}\text{= 11.5±1}$) and a significant amount of epimerization for the hydroxylation of norbornane by cytochrome P-450, suggest an initial hydrogen abstraction to give a carbon radical intermediate.     

Biosynthesis of 5-methylaminomethyl-2-thiouridylate. I. Isolation of a new tRNA-methylase specific for 5-methylaminomethyl-2-thiouridylate

A new enzyme, which catalyzes the transfer of a methyl group to tRNA to form 5-methylaminomethyl-2-thiouridylate, was isolated from $\text{E.}$$\text{coli}$ by a procedure including affinity chromatography. The purified enzyme was nearly homogeneous upon disc electrophoresis. Using methyl-deficient tRNA^Glu of $\text{E.}$$\text{coli}$ as substrate, the 5-methylaminomethyl-2-thiouridylate residue synthesized was mostly found in the anticodon loop, showing a coincidence of the modification site $\text{in}$$\text{vitro}$ with that $\text{in}$$\text{vivo}$.     

The involvement of a non-'bay-region' diol-epoxide in the formation of benz(a)anthracene-DNA adducts in a rat-liver microsomal system

The metabolic activation of benz(a)anthracene was investigated by incubating [³H]-benz(a)anthracene with DNA, a NADPH-generating system and rat-liver microsomes. When hydrolysates of the DNA were chromatographed on Sephadex LH20 columns, three hydrocarbon-nucleoside adduct peaks were resolved and these were further examined using HPLC. One adduct probably results from the reaction of the non-bay-region diol-epoxide $\text{r}$-8,$\text{t}$-9-dihydroxy-$\text{t}$-10,11-oxy-8,9,10,11-tetrahydrobenz(a)anthracene $\text{(}\text{anti}$-BA-8,9-diol 10,11-oxide) with DNA. The other two adducts did not co-chromatograph with adducts formed from any of the four possible isomeric diolepoxides that can be formed in the 8,9,10,11-ring of benz(a)anthracene.     

Isolation, identification and stimulatory activity of a second component of the sex pheremone system (complex) of the female almond moth, Cadra cautella (Walker)

$\text{Cis}$-9-tetradecen-l-ol acetate was isolated from both extracts of female abdominal tips and of filter paper exposed to female $\text{Cadra}$$\text{cautella}$ (Walker). It is the second sex stimulant isolated from this species and, in stimulatory bioassays, it is ca. 1/100, 000 as active as the stimulant isolated previously, $\text{cis}$-9, $\text{trans}$-12-tetradecadien-l-ol acetate. According to attractancy tests, the natural sex pheromone system of complex contains other components in addition to these 2 stimulants.     

Crystallization and preliminary x-ray investigation of ubiquitin, a non-histone chromosomal protein.

Large crystals of bovine thymus ubiquitin, a non-histone chromosomal protein, were grown from polyethylene glycol solutions. The crystals are orthorhombic, space group P2₁2₁2₁, with $\text{a = 50·9}\text{a}\text{?}\text{, b = 42·9}\text{A}\text{?}\text{and}\text{c = 29·0}\text{A}\text{?}$. The asymmetric unit contains one ubiquitin molecule.     

High mutagenicity and toxicity of a diol epoxide derived from benzo[a]pyrene

(±)-7β,8α-Dihydroxy-9β,10β-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BP 7,8-diol-9,10-epoxide) is a suspected metabolite of benzo[a]pyrene that is highly mutagenic and toxic in several strains of $\text{Salmonella}\text{typhimurium}$ and in cultured Chinese hamster V79 cells. BP 7,8-diol-9,10-epoxide was approximately 5, 10 and 40 times more mutagenic than benzo[a]pyrene 4,5-oxide (BP 4,5-oxide) in strains TA 98 and TA 100 of $\text{S.}\text{typhimurium}$ and in V79 cells, respectively. Both compounds were equally mutagenic to strain TA 1538 and non-mutagenic to strain TA 1535 of $\text{S.}\text{typhimurium}$. The diol epoxide was toxic to the four bacterial strains at 0.5–2.0 nmole/plate, whereas BP 4,5-oxide was nontoxic at these concentrations. In V79 cells, the diol epoxide was about 60-fold more cytotoxic than BP 4,5-oxide.     

Two sex pheromone components of the tobacco budworm moth, Heliothis virescens

Two compounds were isolated from female $\text{Heliothis}$$\text{virescens}$ (Lepidoptera: Noctuidae) extracts and identified as $\text{cis}$-9-tetradecenal and $\text{cis}$-ll-hexadecenal. Together they elicit intense male $\text{H}$. $\text{virescnes}$ response in laboratory tests and have attracted males in the field. Although $\text{cis}$-ll-hexadecenal is an $\text{H}$. $\text{zea}$ sex pheromone, no evidence was obtained for $\text{cis}$-9-tetradecenal in $\text{H}$. $\text{zea}$.     

A new class of lipoxygenase inhibitor. Polyunsaturated fatty acids containing sulfur

A series of unsaturated and polyunsaturated fatty acids with a sulfur atom substituting for a methylene unit of the chain has been prepared and characterized. The syntheses were accomplished by the Wittig coupling of the ylid derived from the triphenylphosphonium salt of 9-bromononanoic acid with aldehydes containing sulfur. The newly formed double bond had predominately the natural Z geometry even when the starting aldehyde was conjugated with the sulfur atom. The sulfides 13-thia-9(Z)-octadecenoic acid ($\text{2}$), 13-thia-9(Z), 11(E)-octadecadienoic acid ($\text{5}$) and 13-thia-9(E), 11(E)-octadecadienoic acid ($\text{6}$) were readily converted into their sulfoxide derivatives by treatment with an equivalent amount of m-chloroperoxybenzoic acid. The structures of the novel compounds were confirmed by the application of ir, uv, ¹H-nmr, ¹³C-nmr, and (as methyl esters) chemical ionization mass spectrometry. Two members of this new family of fatty acids ($\text{5}$ and $\text{6}$) were found to inhibit the catalysis of the oxygenation of linoleic acid by soybean type-1 lipoxygenase. The analysis of the kinetic data for compound $\text{5}$ indicated that the type of inhibition was reversible competitive with an inhibition constant of 30 μM.     

Isolation of a complementing activity for a dna-B mutant

A cell free extract which displays temperature sensitive DNA synthesis in the presence of single strand DNA and ATP was prepared from a $\text{dna-B}$ mutant. Following an activity which would reverse this temperature sensitivity, a protein fraction was isolated. The absence of this fraction in a $\text{dna-B}$ mutant indicates that this protein corresponds to the $\text{Dna-B}$ product.     

Structural investigations of mode of action of drugs. I. Molecular structure of mitomycin C.

The crystal and molecular structure of the antitumor antibiotic mitomycin C has been determined by X-ray diffraction. The space group is monoclinic P2₁ with cell dimensions $\text{a}\text{=77.988(3)}$, $\text{b}\text{=20.355(7)}$, $\text{c}\text{=9.679(3)}\text{A}\text{?}$, β=95.99°(1) and Z=4. The structure was solved by direct methods. There are two independent molecules per asymmetric unit. The structure was refined to an R value of 0.049 for 2151 observed reflections measured on diffractometer. The benzoquinone ring is slightly deviated from planarity. The N4 in the indole ring behaves like an amide nitrogen owing to its participation in the conjugated benzoquinoid system. The five membered ring through C1, C2, C3, N4 and C9a adopts an envelope conformation. The molecules are held together in crystal by the hydrogen bonds. All nitrogens except N4 are involved in the hydrogen bonding. Studies with models of drug and DNA indicate two different kinds of mechanism for crosslinking.     

Characterization of the methotrexate transport defect in a resistant L1210 lymphoma cell line

L1210/R81 lymphoma cells are resistant to methotrexate (MTX) by virtue of a 35-fold elevation in dihydrofolate reductase and an inability to transport the folate antagonist drug effectively. In a phosphate-containing buffer there was little or no influx into the resistant cells at either 1 or 50 μm MTX. Replacement of this buffer with a 4-(2-hydroxyethyl)-1-piperazine-N′-2-ethanesulfonic acid-Mg²⁺ system resulted in an apparent influx of MTX into the resistant cells. Under these conditions, L1210/R81 cells achieved an apparent steady state at an extracellular MTX concentration of 50 μm. The apparent steady-state level of 5 nmol $\text{[}{}^3\text{H]MTX}\text{10}{}^9$ cells was well below the intracellular level of dihydrofolate reductase (45 nmol/10⁹ cells). Efflux experiments at the apparent steady state indicated that 60% of the MTX was very rapidly removed from the cells by washing. Over the range of the experiment a further 20% of the MTX effluxed more slowly ($\text{t}{}_{\mathrm{<mtext>1</mtext><mtext>2</mtext>}}\text{= 12}\text{min}$). The apparent influx into the resistant cells at 5 μm MTX was inhibited 13% by sodium azide (100 μm) and initially stimulated, then inhibited, by p-chloromercuriphenylsulfonic acid (100 μm). 5-Methyltetrahydrofolate (100 μm) had little effect on the process while aminopterin (100 μm) was inhibitory (68%). K_t and V values of 2 × 10^?5m and 0.31 nmol $\text{[}{}^3\text{H]MTX}\text{10}{}^9$ cells/min, respectively, were determined for the apparent influx in $\text{L}\text{1210}\text{R}\text{81}$ cells. Comparison of apparent MTX influx in the resistant cells with MTX transport in the sensitive cells indicates profound differences in the two processes. The evidence suggests that the apparent influx in the former cell line may consist of MTX binding to the cell membrane together with a small degree of MTX influx into the intracellular compartment.     

The effect of visible light on the regeneration of rhodopsin

Both $\text{in}\text{vitro}$ and $\text{in}\text{vivo}$, increased exposure to visible light decreases the regenerability of the visual pigment. Isolated opsin irradiated with increasing periods of white light decreased in pigment formation yields on combination with 9- or 11-$\text{cis}$ retinal. The yield of regeneration of the visual pigment extracted from albino rats depended on the amount of light to which the animal had been exposed. Animals exposed to normal room light demonstrated lower regeneration yields than dark-reared animals, but these yields increased on dark adaption. Opsin from animals exposed to sunlamps did not regenerate any pigment. On dark adaption, the pigment yields increased but the opsin level remained below that for the control group.