Synthesis and Triplex Binding Properties of Oligonucleotides Containing a Novel Nucleobase

Abstract

The thiazolo-indole compound 1 bearing the complementary donor-acceptor-donor sites (dad) was designed for specific recognition of an AT inverted base pair in pyrimidine triple helix motif. It was successfully incorporated into 14-mer oligonucleotide using a serinol unit as sugar derivative. The triple helix hybridization studies were examined by means of thermal denaturation experiments with a 26-mer DNA duplex containing the AT inverted base pair.     

Inhibition of restriction endonuclease cleavage via triple helix formation by homopyrimidine oligonucleotides

A 17-mer homopyrimidine oligonucleotide was designed to bind to the major groove of SV40 DNA at a 17 base pair homopurine-homopyrimidine sequence via Hoogsteen base pairing. This sequence contains the recognition site for the class II-S restriction enzyme Ksp 632-I. The oligonucleotide was shown to inhibit enzymatic cleavage under conditions that allow for triple helix formation. Inhibition is sequence-specific and occurs in the micromolar concentration range. Triple helix formation by oligonucleotides opens new possibilities for sequence-specific regulation of gene expression.     

The influence of single base triplet changes on the stability of a pur.pur.pyr triple helix determined by affinity cleaving.

The influence of sixteen base triplet changes at a single position within a pur.pur.pyr triple helix was examined by affinity cleaving. For the 15 base pair target site studied here, G.GC, A.AT and T.AT triplets stabilize a triple helix to a greater extent than the other 13 natural triplets (pH = 7.4, 25 degrees C). Weaker interactions were detected for the C.AT, A.GC and T.CG triplets. The absence of specific, highly stabilizing interactions between third strand bases and the CG or TA base pairs demonstrates a current sequence limitation to formation of this structure. Models for the two dimensional base triplet interactions for all possible 16 natural triplets are presented.     

Proton exchange and local stability in a DNA triple helix containing a G.TA triad

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C⁺.GC triad. The results indicate that, in the G.TA triad, the stability of the Watson–Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6–1.8 kcal/mol at 1°C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.     

Extension of the range of DNA sequences available for triple helix formation: stabilization of mismatched triplexes by acridine-containing oligonucleotides.

Triple helix formation usually requires an oligopyrimidine*oligopurine sequence in the target DNA. A triple helix is destabilized when the oligopyrimidine*oligopurine target contains one (or two) purine*pyrimidine base pair inversion(s). Such an imperfect target sequence can be recognized by a third strand oligonucleotide containing an internally incorporated acridine intercalator facing the inverted purine*pyrimidine base pair(s). The loss of triplex stability due to the mismatch is partially overcome. The stability of triplexes formed at perfect and imperfect target sequences was investigated by UV thermal denaturation experiments. The stabilization provided by an internally incorporated acridine third strand oligonucleotide depends on the sequences flanking the inverted base pair. For triplexes containing a single mismatch the highest stabilization is observed for an acridine or a propanediol tethered to an acridine on its 3'-side facing an inverted A*T base pair and for a cytosine with an acridine incorporated to its 3'-side or a guanine with an acridine at its 5'-side facing an inverted G*C base pair. Fluorescence studies provided evidence that the acridine was intercalated into the triplex. The target sequences containing a double base pair inversion which form very unstable triplexes can still be recognized by oligonucleotides provided they contain an appropriately incorporated acridine facing the double mismatch sites. Selectivity for an A*T base pair inversion was observed with an oligonucleotide containing an acridine incorporated at the mismatched site when this site is flanked by two T*A*T base triplets. These results show that the range of DNA base sequences available for triplex formation can be extended by using oligonucleotide intercalator conjugates.     

Structural constraints regulating triple helix formation by A-tracts

The study concerns the propensity of triple helix formation by different DNA oligonucleotides containing long A-tracts with and without flanking GxC base pairs in order to probe the role of length of the A-tract and the flanking sequences. From nuclear magnetic resonance (NMR) studies of imino proton spectra and circular dichroism (CD) spectroscopy of samples composed of potential triplex forming strand sequences in correct stoichiometries, we have concluded that 8-mer A-tracts flanked by GxC base pairs exert significant steric hindrance to triple helix formation. When as much as 50 mM Mg2+ was added, no triple helix formation was observed in these samples. In contrast, open-ended 8-mer A-tracts formed triplex with the corresponding two T8 strands under relatively mild ionic conditions (100 mM Na+). Moreover, the shorter the length of the A-tract, the less is the hindrance to form a triple helix.     

Structural studies of the O6meG.T interaction in the d(C-G-T-G-A-A-T-T-C-O6meG-C-G) duplex

High-resolution proton and phosphorus NMR studies are reported on the self-complementary d(C1-G2-T3-G4-A5-A6-T7-T8-C9-O6meG10-C11-G12) duplex (henceforth called O6meG.T 12-mer), which contains T3.O6meG10 interactions in the interior of the helix. The imino proton of T3 is observed at 9.0 ppm, exhibits a temperature-independent chemical shift in the premelting transition range, and broadens out at the same temperature as the imino proton of the adjacent G2.C11 toward the end of the helix at pH 6.8. We observed inter base pair nuclear Overhauser effects (NOEs) between the base protons at the T3.O6meG10 modification site and the protons of flanking G2.C11 and G4.C9 base pairs, indicative of the stacking of the T3 and O6meG10 bases into the helix. Two-dimensional correlated (COSY) and nuclear Overhauser effect (NOESY) studies have permitted assignment of the base and sugar H1', H2', and H2' nonexchangeable protons in the O6meG.T 12-mer duplex. The observed NOEs demonstrate an anti conformation about all the glycosidic bonds, and their directionality supports formation of a right-handed helix in solution. The observed NOEs between the T3.O6meG10 interaction and the adjacent G2.C11 and G4.C9 base pairs at the modification site exhibit small departures from patterns for a regular helix in the O6.meG.T 12-mer duplex. The phosphorus resonances exhibit a 0.5 ppm spectral dispersion indicative of an unperturbed phosphodiester backbone for the O6meG.T 12-mer duplex. We propose a model for pairing of T3 and O6meG10 at the modification site in the O6meG.T 12-mer duplex.(ABSTRACT TRUNCATED AT 250 WORDS)     

Solution structure of a GAAG tetraloop in helix 6 of SRP RNA from Pyrococcus furiosus

The NMR structure of a 12-mer RNA derived from the helix 6 of SRP RNA from Pyrococcus furiosus, whose loop-closing base pair is U.G, was determined, and the structural and thermodynamic properties of the RNA were compared with those of a mutant RNA with the C:G closing base pair. Although the structures of the two RNAs are similar to each other and adopt the GNRR motif the conformational stabilities are significantly different to each other It was suggested that weaker stacking interaction of the GAAG loop with the U:G closing base pair in 12-mer RNA causes the lower conformational stability.     

NMR structural studies of intramolecular (Y+)n.(R+)n(Y-)nDNA triplexes in solution: imino and amino proton and nitrogen markers of G.TA base triple formation.

We reported previously on NMR studies of (Y+)n.(R+)n(Y-)n DNA triple helices containing one oligopurine strand (R)n and two oligopyrimidine strands (Y)n stabilized by T.AT and C+.GC base triples [de los Santos, C., Rosen, M., & Patel, D. J. (1989) Biochemistry 28, 7282-7289]. Recently, it has been established that guanosine can recognize a thymidine.adenosine base pair to form a G.TA triple in an otherwise (Y+)n.(R+)n(Y-)n triple-helix motif. [Griffin, L. C., & Dervan, P. B. (1989) Science 245, 967-971]. The present study extends the NMR research to the characterization of structural features of a 31-mer deoxyoligonucleotide that folds intramolecularly into a 7-mer (Y+)n.(R+)n(Y-)n triplex with the strands linked through two T5 loops and that contains a central G.TA triple flanked by T.AT triples. The G.TA triplex exhibits an unusually well resolved and narrow imino and amino exchangeable proton and nonexchangeable proton spectrum in H2O solution, pH 4.85, at 5 degrees C. We have assigned the imino protons of thymidine and amino protons of adenosine involved in Watson-Crick and Hoogsteen pairing in T.AT triples, as well as the guanosine imino and cytidine amino protons involved in Watson-Crick pairing and the protonated cytidine imino and amino protons involved in Hoogsteen pairing in C+.GC triples in the NOESY spectrum of the G.TA triplex. The NMR data are consistent with the proposed pairing alignment for the G.TA triple where the guanosine in an anti orientation pairs through a single hydrogen bond from one of its 2-amino protons to the 4-carbonyl group of thymidine in the Watson-Crick TA pair.(ABSTRACT TRUNCATED AT 250 WORDS)     

Synthesis and duplex DNA recognition studies of oligonucleotides containing a ureido isoindolin-1-one homo-N-nucleoside. A comparison of host-guest and DNA recognition studies

In an effort to construct non-natural bases to be used in triplex-based antigene DNA recognition strategies, a uriedo-isoindolin-1-one homo-N-nucleoside base was designed to bind the cytosine-guanine (CG) base pair. An organic soluble analogue of this base was shown to effectively complex CG (K(assoc)=740M(-1)) in chloroform through formation of three hydrogen bonds (Mertz, E.; Mattei, S.; Zimmerman, S. C. Org. Lett. 2000, 2, 2931-2934). The novel nucleoside base was synthesized and successfully incorporated into oligonucleotides which were used in triple helix melting temperature studies. Low melting temperatures were observed when the isoindolin-1-one base was paired opposite CG as well as GC, TA, and AT, thus indicating that despite favorable recognition in model studies, the artificial base did not effectively recognize duplex DNA to form pyrimidine-purine-pyrimidine type triple helices.     

Solution Structure of a GAAG Tetraloop in Helix 6 of SRP RNA from Pyrococcus furiosus

The NMR structure of a 12-mer RNA derived from the helix 6 of SRP RNA from Pyrococcus furiosus, whose loop-closing base pair is U:G, was determined, and the structural and thermodynamic properties of the RNA were compared with those of a mutant RNA with the C:G closing base pair. Although the structures of the two RNAs are similar to each other and adopt the GNRR motif, the conformational stabilities are significantly different to each other. It was suggested that weaker stacking interaction of the GAAG loop with the U:G closing base pair in 12-mer RNA causes the lower conformational stability.     

Crystal structure of an RNA helix recognized by a zinc-finger protein: an 18-bp duplex at 1.6 A resolution

The crystal structure of the 19-mer RNA, 5'-GAAUGCCUGCGAGCAUCCC-3' has been determined from X-ray diffraction data to 1.6 A resolution by the multiwavelength anomalous diffraction method from crystals containing a brominated uridine. In the crystal, this RNA forms an 18-mer self-complementary double helix with the 19th nucleotide flipped out of the helix. This helix contains most of the target stem recognized by the bacteriophage Mu Com protein (control of mom), which activates translation of an unusual DNA modification enzyme, Mom. The 19-mer duplex, which contains one A.C mismatch and one A.C/G.U tandem wobble pair, was shown to bind to the Com protein by native gel electrophoresis shift assay. Comparison of the geometries and base stacking properties between Watson-Crick base pairs and the mismatches in the crystal structure suggest that both hydrogen bonding and base stacking are important for stabilizing these mismatched base pairs, and that the unusual geometry adopted by the A.C mismatch may reveal a unique structural motif required for the function of Com.     

Design of artificial nucleobases for the recognition of the AT inversion by triple-helix forming oligonucleotides: a structure-stability relationship study and neighbour bases effect

We report herein on the synthesis, the incorporation into triplex forming oligonucleotides (TFO) and the recognition properties of a series of synthetic nucleosides designed for the specific recognition of an inverted A x T base pair in a pyrimidine triple helix motif. These analogues were designed on the basis of the results obtained with our previously reported compounds S and B(t), in order to define a structure-stability relationship. We report also on the chemical nature effect of the bases flanking S in the case of S-containing TFOs, in order to get further informations about the recognition process within the A x TxS triplet. This study establishes guidelines for the conception of more potent analogues for the recognition of both A x T and G x C inverted base pairs.     

Possibilities of Triplex-Formation by 21-Mer Oligodeoxyribonucleotides as Analogs of Tetrahymena Pre-rRNA Fragments

Abstract

A potential DNA triple helix of 21-mer oligodeoxyribonucleotides was synthesized and characterized. The strands were chosen to study the interaction of internal guide and intervening sequences analogs as well as adjacent 3′and 5′exon parts around the splicing site of Tetrahymena pre-rRNA. Further in parallel works a series of different RNA and DNA strands was synthesized and combined yielding a suitable order of stability. Here we want to show an isolated examination of a DNA-strand triple helix with defined sequences containing a central mismatched base arrangement and T-A-T bases at the ends.     

Nuclear magnetic resonance structural studies of intramolecular purine.purine.pyrimidine DNA triplexes in solution. Base triple pairing alignments and strand direction

Recently, P.A. Beal and P.B. Dervan, expanding on earlier observations by others, have established the formation of purine.purine.pyrimidine triple helices stabilized by G.GC, A.AT and T.AT base triples where the purine-rich third strand was positioned in the major groove of the Watson-Crick duplex and anti-parallel to its purine strand. The present nuclear magnetic resonance (n.m.r.) study characterizes the base triple pairing alignments and strand direction in a 31-mer deoxyoligonucleotide that intramolecularly folds to generate a 7-mer (R/Y-)n.(R+)n(Y-)n triplex with the strands linked by two T5 loops and stabilized by potential T.AT and G.GC base triples. (R and Y stand for purine and pyrimidine, respectively, while the signs establish the strand direction.) This intramolecular triplex gives well-resolved exchangeable and non-exchangeable proton spectra with Li+ as counterion in aqueous solution. These studies establish that the T1 to C7 pyrimidine and the G8 to A14 purine strands are anti-parallel to each other and align through Watson-Crick A.T and G.C pair formation. The T15 to G21 purine-rich third strand is positioned in the major groove of this duplex and pairs through Hoogsteen alignment with the purine strand to generate T.AT and G.GC triples. Several lines of evidence establish that the thymidine and guanosine bases in the T15 to G21 purine-rich third strand adopt anti glycosidic torsion angles under conditions where this strand is aligned anti-parallel to the G8 to A14 purine strand. We have also recorded imino proton n.m.r. spectra for an (R-)n.(R+)n(Y-)n triplex stabilized by G.GC and A.AT triples through intramolecular folding of a related 31-mer deoxyoligonucleotide with Li+ as counterion. The intramolecular purine.purine.pyrimidine triplexes containing unprotonated G.GC, A.AT and T.AT triples are stable at basic pH in contrast to pyrimidine.purine.pyrimidine triplexes containing protonated C+.GC and T.AT triples, which are only stable at acidic pH.     

Triple helical DNA in a duplex context and base pair opening

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region.     

A directional nucleation-zipping mechanism for triple helix formation

A detailed kinetic study of triple helix formation was performed by surface plasmon resonance. Three systems were investigated involving 15mer pyrimidine oligonucleotides as third strands. Rate constants and activation energies were validated by comparison with thermodynamic values calculated from UV-melting analysis. Replacement of a T·A base pair by a C·G pair at either the 5′ or the 3′ end of the target sequence allowed us to assess mismatch effects and to delineate the mechanism of triple helix formation. Our data show that the association rate constant is governed by the sequence of base triplets on the 5′ side of the triplex (referred to as the 5′ side of the target oligopurine strand) and provides evidence that the reaction pathway for triple helix formation in the pyrimidine motif proceeds from the 5′ end to the 3′ end of the triplex according to the nucleation-zipping model. It seems that this is a general feature for all triple helices formation, probably due to the right-handedness of the DNA double helix that provides a stronger base stacking at the 5′ than at the 3′ duplex–triplex junction. Understanding the mechanism of triple helix formation is not only of fundamental interest, but may also help in designing better triple helix-forming oligonucleotides for gene targeting and control of gene expression.     

Temperature-jump kinetics of the dC-G-T-G-A-A-T-T-C-G-C-G double helix containing a G . T base pair and the dC-G-C-A-G-A-A-T-T-C-G-C-G double helix containing an extra adenine

The kinetics of helix formation were investigated using the temperature-jump technique for the following two molecules: dC-G-T-G-A-A-T-T-C-G-C-G, which forms a double helix containing a G·T base pair(the G·T 12-mer), and dC-G-C-A-G-A-A-T-T-C-G-C-G, which forms a double helix containing an extra adenine (the 13-mer). When data were analyzed in an all-or-none model, the activation energy for the helix association process was 22 ± 4 kcal/mol for the G·T 12-mer and 16 ± 7 kcal/mol for the 13-mer. The activation energy for the helix-dissociation process was 68 ± 2 kcal/mol for the G·T 12-mer and 74 ± 3 kcal/mol for the 13-mer. Rate constants for recombination were near 10⁵s^?1M^?1 in the temperature range from 32 to 47°C; for the dissociation process, the rate constants varied from 1s^?1 near 32°C to 130s^?1 near 47°C. Possible effects of hairpin loops and fraying ends on the above data are discussed.     

Interaction of amphiphilic cyclic peptide with double and triple stranded DNA.

It was found that Gramicidin S (GS) with intramolecular antiparallel beta-sheet structure could bind to and thermally stabilize double and triple stranded DNA. UV melting study revealed that GS stabilized mixed sequence dsDNA in the presence of Mg2+ (deltaTm = +6.0) but it stabilized dsDNA with homosequence only in the absence of Mg2+. It should be pointed out that GS specifically stabilized the third strand (Hoogsteen base pair) but not double strand (Watson-Crick base pair) in triple helix DNA.