New Solid Supports Linking Nucleoside Scaffolds

Abstract

An easy and efficient strategy to obtain new nucleoside based solid supports in which the nucleoside moieties have been anchored to the solid support through the nucleobase is here proposed. A simple and efficient solid-phase synthesis of 5′ and 3′-derivatized uridine analogues has so been developed, following methodologies well established in organic chemistry.     

New reagents and solid support for automated oligonucleotide synthesis

The optimal system for the rapid, efficient, convenient, and economical synthesis and purification of synthetic oligonucleotides has been advancing. By recognizing the very rapid reaction kinetics and taking advantage of an efficient, low volume delivery system, cycle times have decreased to about 5.5 minutes, without compromising synthesis performance. A new set of base protecting groups for cyanoethylphosphoramidite nucleoside monomers have been developed, which decreases the post-synthesis time requirements. A particular form of polystyrene has also been developed as a solid support for automated oligonucleotide synthesis. Typical sequencing or PCR primers (20mers) now require less than 2 hours for synthesis and 2 hours for cleavage and deprotection.     

Immobilized Biocatalysts for the Production of Nucleosides and Nucleoside Analogues by Enzymatic Transglycosylation Reactions

The recombinant enzymes uridine phosphorylase (UP) and purine nucleoside phosphorylase (PNP) were over-expressed in high-biomass bacterial fermentations and co-immobilized, without previous purification, on epoxy-activated solid supports by covalent linkages. These preparations are efficient biocatalysts of transglycosylation reactions and have been developed for producting natural and modified nucleosides of pharmaceutical interest in the field of antiviral and antitumoral agents. The new biocatalysts described in this work are suitable for both laboratory and industrial scale applications due to the maintainance of high catalytic efficiency, thermal and solvent stability, reusability and ease of operation in batch as well as in continuous reactions.     

Synthesis of mixed oligodeoxyribonucleotides following the solid phase method.

A method for the synthesis of mixed dimers, trimers and oligonucleotides on a solid support using monomeric protected nucleoside phosphochloridites (1a-d) has been developed and the different nucleoside reagents, and the results show that yields of different oligomers in a mixture could be directly correlated to the concentration of the four reagents. Separation of mixed oligomers on a reversed phase C18 column has also been studied.     

New insights on nucleoside 2′-deoxyribosyltransferases: a versatile Biocatalyst for one-pot one-step synthesis of nucleoside analogs

In recent years, glycosiltransferases have arisen as standard biocatalysts for the enzymatic synthesis of a wide variety of natural and non-natural nucleosides. Such enzymatic synthesis of nucleoside analogs catalyzed by nucleoside phosphorylases and 2′-deoxyribosyltransferases (NDTs) has demonstrated to be an efficient alternative to the traditional multistep chemical methods, since chemical glycosylation reactions include several protection–deprotection steps. This minireview exhaustively covers literature reports on this topic with the final aim of presenting NDTs as an efficient option to nucleoside phosphorylases for the synthesis of natural and non-natural nucleosides. Detailed comments about structure and catalytic mechanism of described NDTs, as well as their possible biological role, substrate specificity, and advances in detection of new enzyme specificities towards different non-natural nucleoside synthesis are included. In addition, optimization of enzymatic transglycosylation reactions and their application in the synthesis of natural and non-natural nucleosides have been described. Finally, immobilization of NDTs is shown as a practical procedure which leads to the preparation of very interesting biocatalysts applicable to industrial nucleoside synthesis.     

Aryl nucleoside H-phosphonates. Part 16: Synthesis and anti-HIV-1 activity of di-aryl nucleoside phosphotriesters

Di-aryl nucleoside phosphotriesters have been explored as a new type of pronucleotides for the purpose of anti-HIV-1 therapy and efficient synthetic protocols, based on H-phosphonate chemistry, have been developed for the preparation of this class of compounds. It was found that anti-HIV-1 activity of the phosphotriesters bearing an antiviral nucleoside moiety (AZT, ddA) and also ddU was due, at least partially, to intracellular conversion into the corresponding nucleoside 5′-monophosphates, and their efficiency correlated well with the pK_a values of the aryloxy groups present.     

alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.     

Diastereomeric process control in the synthesis of 2'-O-(2-methoxyethyl) oligoribonucleotide phosphorothioates as antisense drugs

Coupling of 2'-O-methoxyethylsubstituted nucleoside phosphoramidites to 5'-hydroxyl group of a nucleoside or nucleotide on solid support is under stereochemical process control and is independent of scale, concentration, synthesizer, ratio of amidite diastereomers, solid support etc. However, activators and phosphate protecting groups do play a role in influencing the ratio of phosphorothioate diesters obtained by sulfurization of phosphite triesters.     

Practical Synthesis of AZT and AZDU from Xylose: Efficient Deoxygenation via Nucleoside 2′-Xanthates

Abstract

An efficient deoxygenation procedure for nucleoside 2′-xanthates has been developed and applied to the total synthesis of AZT and AZDU from xylose.     

Synthesis and fluorescent properties of 5-(1-pyrenylethynyl)-2'- deoxyuridine-containing oligodeoxynucleotides

Novel reagents for the fluorescent labeling of oligo- and polynucleotides have been prepared: 5-(1-pyrenylethynyl)-2'-deoxyuridine 3'-phosphoramidite and a solid support carrying this nucleoside. Oligonucleotides containing one or several modified units have been synthesized, and the fluorescence of these probes has been shown to change upon hybridization with the complementary sequence.     

A new and short convergent synthetic strategy to carbocyclic nucleosides

An efficient synthesis for racemic cyclopent-3-en-1-yl nucleoside analogues has been developed starting from cyclopentadiene. The key step is the regioselective hydroboration of a mixture of intermediate alkylatede cyclopentadienes to give one cyclopentenol.     

Preparation of nucleoside H-phosphonoselenoate monoesters via the phosphinate approach

An efficient entry to nucleoside 3'-H-phosphonoselenoate monoesters via phosphinate intermediates was developed. It involves a reaction of suitably protected nucleosides with triethylammonium phosphinate in the presence of pivaloyl chloride, followed by selenization of the intermediate nucleoside phosphinates with triphenylphosphine selenide, to produce the corresponding nucleoside H-phosphonoselenoates in 86-92% yields.     

Synthetic Approaches to Oligodeoxyribonucleoside Phosphorodithioates Using Tervalent Phosphorus Monomers

Abstract

Two routes to the title compounds using nucleoside phosphorodiamidites or thiophosphoramidites have been explored. A suitably substituted thymidine thiophosphoramidite could be used for tetrazole catalysed solid support syntheses of oligomers (2 to 10 mers).     

Diastereomeric Process Control in the Synthesis of 2′-O-(2-Methoxyethyl) Oligoribonucleotide Phosphorothioates as Antisense Drugs

Abstract

Coupling of 2′-O-methoxyethylsubstituted nucleoside phosphoramidites to 5′-hydroxyl group of a nucleoside or nucleotide on solid support is under stereochemical process control and is independent of scale, concentration, synthesizer, ratio of amidite diastereomers, solid support etc. However, activators and phosphate protecting groups do play a role in influencing the ratio of phosphorothioate diesters obtained by sulfurization of phosphite triesters.     

Preparation of Nucleoside H-Phosphonoselenoate Monoesters Via the Phosphinate Approach

An efficient entry to nucleoside 3′-H-phosphonoselenoate monoesters via phosphinate intermediates was developed. It involves a reaction of suitably protected nucleosides with triethylammonium phosphinate in the presence of pivaloyl chloride, followed by selenization of the intermediate nucleoside phosphinates with triphenylphosphine selenide, to produce the corresponding nucleoside H-phosphonoselenoates in 86–92% yields.     

Genetic studies on the role of the nucleoside transport function in nucleoside efflux, the inosine cycle, and purine biosynthesis.

A mutant clone (AU-100) which is 90% deficient in adenylosuccinate synthetase activity was characterized from wild-type murine S49 T-lymphoma cells. This AU-100 cell line and its hypoxanthine-guanine phosphoribosyltransferase-deficient derivative, AUTG-50B, overproduce purines severalfold and excrete massive amounts of inosine into the culture medium (Ullman et al., Proc. Natl. Acad. Sci. U.S.A. 79:5127-5131, 1982). We introduced a mutation into both of these cell lines which make them incapable of taking up nucleosides from the culture medium. The genetic deficiency in nucleoside transport prevents the adenylosuccinate synthetase-deficient AU-100 cells from excreting inosine. Because of an extremely efficient intracellular inosine salvage system, the nucleoside transport-deficient AU-100 cells also no longer overproduce purines. AUTG-50B cells which have been made genetically deficient in nucleoside transport still overproduce purines but excrete hypoxanthine rather than inosine. These studies demonstrate genetically that nucleoside transport and nucleoside efflux share a common component and that nucleoside transport has an important regulatory function which profoundly affects the rates of purine biosynthesis and purine salvage.     

Synthesis of oligodeoxyribonucleotides containing 5-fluoro-2'-deoxyribocytidine]

A synthesis of the phosphoroamidite derivative of 5-fluoro-2'-deoxycytidine which allows one to introduce the modified nucleoside residue into the 5'-position of the oligodeoxyribonucleotide by the standard solid phase phosphoroamidite method, has been carried out. Oligonucleotides with 5-fluoro-2'-deoxycytidine residues in various positions of the DNA strand are obtained by the combination of chemical and enzymatic syntheses.     

Structural modifications of nucleosides in ionic liquids

Nucleoside chemistry represents an important research area for drug discovery, as many nucleoside analogs are prominent drugs and have been widely applied for cancer and viral chemotherapy. However, the synthesis of modified nucleosides presents a major challenge, which is further aggravated by poor solubility of these compounds in common organic solvents. Most of the currently available methods for nucleoside modification employ toxic high boiling solvents; require long reaction time and tedious workup methods. As such, there is constant effort to develop process chemistry in alternative medium to limit the use of organic solvents that are hazardous to the environment and can be deleterious to human health. One such approach is to use ionic liquids, which are ‘designer materials’ with unique and tunable physico-chemical properties. Studies have shown that methodologies using ionic liquids are highly efficient and convenient for the synthesis of nucleoside analogs, as demonstrated by the preparation of pharmaceutically important anti-viral drugs. This article summarizes recent efforts on nucleoside modification using ionic liquids.     

Synthesis of a convenient thymidine glycol phosphoramidite monomer and its site-specific incorporation into DNA fragments

An original phosphoramidite building block of the thymidine glycol lesion has been prepared taking into account the additional diol function and the high lability of this oxidatively induced nucleobase damage. Then the modified nucleoside was site-specifically inserted into DNA fragments by solid support assembling followed by a "one-step" mild final deprotection treatment.     

Determining the structural basis for specificity of ligands using crystallographic screening

Crystallographic screening has been used to identify new inhibitors for potential target for drug development. Here, we describe the application of the crystallographic screening to assess the structural basis of specificity of ligands against a protein target. The method is efficient and results in detailed crystallographic information. The utility of the method is demonstrated in the study of the structural basis for specificity of ligands for human purine nucleoside phosphorylase (PNP). Purine nucleoside phosphorylase catalyzes the phosphorolysis of the N-ribosidic bonds of purine nucleotides and deoxynucleosides. This enzyme is a target for inhibitor development aiming at T-cell immune response modulation and has been submitted to extensive structure-based drug design. This methodology may help in the future development of a new generation of PNP inhibitors.