Sequence-dependent base pair opening in DNA double helix

Preservation of genetic information in DNA relies on shielding the nucleobases from damage within the double helix. Thermal fluctuations lead to infrequent events of the Watson-Crick basepair opening, or DNA "breathing", thus making normally buried groups available for modification and interaction with proteins. Fluctuational basepair opening implies the disruption of hydrogen bonds between the complementary bases and flipping of the base out of the helical stack. Prediction of sequence-dependent basepair opening probabilities in DNA is based on separation of the two major contributions to the stability of the double helix: lateral pairing between the complementary bases and stacking of the pairs along the helical axis. The partition function calculates the basepair opening probability at every position based on the loss of two stacking interactions and one base-pairing. Our model also includes a term accounting for the unfavorable positioning of the exposed base, which proceeds through a formation of a highly constrained small loop, or a ring. Quantitatively, the ring factor is found as an adjustable parameter from the comparison of the theoretical basepair opening probabilities and the experimental data on short DNA duplexes measured by NMR spectroscopy. We find that these thermodynamic parameters suggest nonobvious sequence dependent basepair opening probabilities.     

Proton exchange and local stability in a DNA triple helix containing a G.TA triad

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C⁺.GC triad. The results indicate that, in the G.TA triad, the stability of the Watson–Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6–1.8 kcal/mol at 1°C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.     

Triple helical DNA in a duplex context and base pair opening

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region.     

Effects of sequence and length on imino proton exchange and base pair opening kinetics in DNA oligonucleotide duplexes.

The base catalysed imino proton exchange in DNA oligonucleotides of different sequences and lengths was studied by 1H-NMR saturation recovery experiments. The self-complementary sequences studied were GCGCGAATTCGCGC (I), CGCGAATTCGCG (II), GCGAATTCGC (III), and CGCGATCGCG (IV). The evaluation of base pair lifetimes was made after correction for the measured 'absence of added catalyst' effect which was found to be characterized by recovery times of 400-500 ms for the AT base pairs and 250-300 ms for the GC base pairs at 15 degrees C. End effects with rapid exchange is noticeable up to 3 base pairs from either end of the duplexes. The inner hexamer cores GAATTC of sequences I-II show similar base pair lifetime patterns, around 30 ms for the innermost AT, 5-10 ms for the outer AT and 20-50 ms for the GC base pairs at 15 degrees C. The shorter sequences III and particularly IV show much shorter lifetimes in their central AT base pairs (11 ms and 1 ms, respectively).     

DNA triple helix stabilisation by a naphthylquinoline dimer

We have used DNase I footprinting to examine the effect of a novel naphthylquinoline dimer, designed as a triplex-specific bis-intercalator, on the stability of intermolecular DNA triplexes. We find that this compound efficiently promotes triplex formation between the 9-mer oligonucleotide 5'-TTTTTTCTT and its oligopurine duplex target at concentrations as low as 0.1 microM, enhancing the triplex stability by at least 1000-fold. This compound, which is the first reported example of a triplex bis-intercalator, is about 30 times more potent than the simple monofunctional ligand.     

Altered structural fluctuations in duplex RNA versus DNA: a conformational switch involving base pair opening

DNA and RNA are known to have different structural properties. In the present study, molecular dynamics (MD) simulations on a series of RNA and DNA duplexes indicate differential structural flexibility for the two classes of oligonucleotides. In duplex RNA, multiple base pairs experienced local opening events into the major groove on the nanosecond time scale, while such events were not observed in the DNA simulations. Three factors are indicated to be responsible for the base opening events in RNA: solvent-base interactions, 2'OH(n)-O4'(n+1) intra-strand hydrogen bonding, and enhanced rigid body motion of RNA at the nucleoside level. Water molecules in the major groove of RNA contribute to initiation of base pair opening. Stabilization of the base pair open state is due to a 'conformational switch' comprised of 2'OH(n)-O4'(n+1) hydrogen bonding and a rigid body motion of the nucleoside moiety in RNA. This rigid body motion is associated with decreased flexibility of the glycosyl linkage and sugar moieties in A-form structures. The observed opening rates in RNA are consistent with the imino proton exchange experiments for AU base pairs, although not for GC base pairs, while structural and flexibility changes associated with the proposed conformational switch are consistent with survey data of RNA and DNA crystal structures. The possible relevance of base pair opening events in RNA to its many biological functions is discussed.     

High base pair opening rates in tracts of GC base pairs

Sequence-dependent structural features of the DNA double helix have a strong influence on the base pair opening dynamics. Here we report a detailed study of the kinetics of base pair breathing in tracts of GC base pairs in DNA duplexes derived from 1H NMR measurements of the imino proton exchange rates upon titration with the exchange catalyst ammonia. In the limit of infinite exchange catalyst concentration, the exchange times of the guanine imino protons of the GC tracts extrapolate to much shorter base pair lifetimes than commonly observed for isolated GC base pairs. The base pair lifetimes in the GC tracts are below 5 ms for almost all of the base pairs. The unusually rapid base pair opening dynamics of GC tracts are in striking contrast to the behavior of AT tracts, where very long base pair lifetimes are observed. The implication of these findings for the structural principles governing spontaneous helix opening as well as the DNA-binding specificity of the cytosine-5-methyltransferases, where flipping of the cytosine base has been observed, are discussed.     

Binding of netropsin to a DNA triple helix.

The interaction of netropsin, a minor groove binding drug, with T-A-T triple helix and A-T double helix was studied using circular dichroism spectroscopy and thermal denaturation. The triple helix was made by an oligonucleotide (dA)12-x-(dT)12-x-(dT)12, where x is a hexaethylene glycol chain bridged between the 3' phosphate of one strand and the 5' phosphate of the following strand. This oligonucleotide is able to fold back on itself to form a very stable triplex. Changing the conditions allows the same oligonucleotide in a duplex form with a (dT)12 dangling arm. Circular dichroism spectroscopy demonstrates that netropsin can bind to the triple helical structure. Spectral analysis shows that the bound drug exhibits a conformation and an environment similar in double-stranded and in triple-stranded structure. However, the binding constant to the triple-stranded structure is found smaller than the binding constant to the double-stranded one. Thermal denaturation experiments demonstrate that netropsin destabilizes the triplex whereas it stabilizes the duplex.     

Energetics of base pair opening in a DNA dodecamer containing an A3T3 tract.

Nuclear magnetic resonance spectroscopy has been used to characterize the kinetics and energetics of opening of base pairs in the DNA dodecamer [d(CGCAAATTTGCG)]2. The dodecamer contains an A3T3 tract that induces intrinsic curvature of the helix axis. Previous studies from this and other laboratories have shown that the kinetics of base pair opening in AnTn tracts is unique: the opening rates of the A.T base pairs in the interior of the tract are much lower than that of the A.T base pair at the 5'-end of the tract. In the present work, we have investigated the energetics of the pathways for opening of the A.T base pairs in the A3T3 tract. The energetic parameters of the activated state(s) are obtained from the temperature dependence of the opening rate constants. The lower opening rates for the A.T base pairs situated in the interior of the tract are shown to originate from higher activation enthalpies which are compensated, in part, by increases in the activation entropies. We have also obtained an energetic characterization of the open state(s) of the A.T base pairs in the dodecamer by measuring the equilibrium constants for base pair opening and their temperature dependence. The results suggest that the transitions from closed to open state(s) in the A.T base pairs of the A3T3 tract are energetically similar.     

Recognition of a G-C base pair by α-N-deoxyinosine within the pyrimidine-purine-pyrimidine DNA triple helical motif

The α-nucleoside 7-(2′-deoxy-α-D-ribofuranosyl)hypoxanthine, incorporated into an otherwise β-configured oligodeoxynucleotide that is designed to bind to a DNA duplex in the parallel motif, recognizes selectively and efficiently a G-C base pair, presumably via monodentate α-H⁷·G-C base-triple formation.     

Thermodynamics and kinetics for base pair opening in the DNA decamer duplexes containing cyclobutane pyrimidine dimer

The cyclobutane pyrimidine dimer (CPD) is one of the major classes of cytotoxic and carcinogenic DNA photoproducts induced by UV light. Hydrogen exchange rates of the imino protons were measured for various CPD-containing DNA duplexes to better understand the mechanism for CPD recognition by XPC-hHR23B. The results here revealed that double T·G mismatches in a CPD lesion significantly destabilized six consecutive base pairs compared to other DNA duplexes. This flexibility in a DNA duplex caused at the CPD lesions with double T·G mismatches might be the key factor for damage recognition by XPC-hHR23B.     

DNA triple helix stabilization by aminoglycoside antibiotics

The stabilization of the poly(dA) x 2poly(dT) triple helix by neomycin is reported. Preliminary results indicate that neomycin stabilizes DNA triple helices and the double helical structures composed of poly(dA) x poly(dT) are virtually unaffected. This is the first report of the interaction of aminoglycoside antibiotics with DNA triple helices.     

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

Complex between triple helix of collagen and double helix of DNA in aqueous solution

We demonstrate in this paper that one example of a biologically important and molecular self-assembling complex system is a collagen–DNA ordered aggregate which spontaneously forms in aqueous solutions. Interaction between the collagen and the DNA leads to destruction of the hydration shell of the triple helix and stabilization of the double helix structure. From a molecular biology point of view this nano-scale self-assembling superstructure could increase the stability of DNA against the nucleases during collagen diseases and the growth of collagen fibrills in the presence of DNA.     

Characterization and quantification of triple helix formation in chromosomal DNA

DNA-binding molecules that recognize specific sequences offer a high potential for the understanding of chromatin structure and associated biological processes in addition to their therapeutic potential, e.g. as positioning agents for validated anticancer drugs. A prerequisite for the development of DNA-binding molecules is the availability of appropriate methods to assess their binding properties quantitatively at the desired target sequence in the human genome. We have further developed a capture assay to assess triplex-forming oligonucleotide (TFO) binding efficiency quantitatively. This assay is based on bifunctional, psoralen and biotin-conjugated, TFOs and real-time PCR analysis. We have applied this novel quantification method to address two issues that are relevant for DNA-binding molecules. First, we have compared directly the extent of TFO-binding in three experimental settings with increasing similarity to the situation in vivo, i.e. naked genomic DNA, isolated cell nuclei, or whole cells. This comparison allows us to characterize factors that influence genomic triplex formation, e.g. chromosomal DNA organization or intracellular milieu. In isolated nuclei, the binding was threefold lower compared to naked DNA, consistent with a decreased target accessibility int he nucleosomal environment. Binding was detected in whole cells, indicating that the TFO enters the nucleus and binds to its target in intact cells in vivo, but the efficiency was decreased (tenfold) compared to nuclei. Secondly, we applied the method to characterize the binding properties of two different TFOs targeting the same sequence. We found that an antiparallel-binding GT-containing TFO bound more efficiently, but with less target sequence selectivity compared to a parallel-binding CU-containing TFO. Collectively, a sensitive method to characterize genomic triplex formation was described. This may be useful for the determination of factors driving TFO binding efficiency and, thus, may improve the usefulness of triplex-mediated gene targeting for studies of chromatin structure as well as for therapeutic antigene strategies.     

Probing DNA triple helix structure by chemical ligation

A series of oligomeric double and triple helical DNAs with irregular sequences of homopurine and homopyrimidine strands were prepared. DNA triplexes were identified by CD spectroscopy and thermal denaturation profiles (biphasic helix-coil transition). Condensation of oligonucleotides on single and double-stranded DNA templates was performed using water-soluble carbodiimide, phosphodiester and pyrophosphate internucleotide bonds being newly formed. Such chemical ligation proved to be a sensitive monitor of changes in the sugar-phosphate backbone resulting from conversion of double to triple helix and of third-strand binding.     

Polyamine-linked oligonucleotides for DNA triple helix formation.

The concept of antigene therapy of disease is based on the ability of an oligonucleotide (the therapeutic agent) to bind to double-stranded genomic DNA (the target associated with the disease). Examples are herein given of the linkage of a series of polyamines to a 21-mer homopyrimidine oligonucleotide. These conjugated 21-mers can each form a triple helix with an appropriate double-stranded homopurine-homopyrimidine DNA according to Hoogsteen base-pairing rules. No triple helix was found when unmodified third strand was used at 10 mM sodium phosphate, pH 6.5, 100 mM sodium chloride solution. In contrast, the spermine-conjugated oligonucleotide had a melting temperature of 42 degrees C. According to the melting profile, the appended spermine moiety was found to affect the Tm only of the triple helix, but not of the subsequent melting of the underlying double helix. The Tm enhancing ability of the spermine-conjugate was found to be better than that of other polyamine-conjugates.     

Initiation of DNA replication by DNA polymerases from primers forming a triple helix

Despite extensive studies on oligonucleotide-forming triple helices, which were discovered in 1957, their possible relevance in the initiation of DNA replication remains unknown. Using sequences forming triple helices, we have developed a DNA polymerisation assay by using hairpin DNA templates with a 3′ dideoxynucleotide end and an unpaired 5′-end extension to be replicated. The T7 DNA polymerase successfully elongated nucleotides to the expected size of the template from the primers forming triple helices composed of 9–14 deoxyguanosine-rich residues. The triple helix-forming primer required for this reaction has to be oriented parallel to the homologous sequence of the hairpin DNA template. Substitution of the deoxyguanosine residues by N7 deazadeoxyguanosines in the hairpin of the template prevented primer elongation, suggesting that the formation of a triple helix is a prerequisite for primer elongation. Furthermore, DNA sequencing could be achieved with the hairpin template through partial elongation of the third DNA strand forming primer. The T4 DNA polymerase and the Klenow fragment of DNA polymerase I provided similar DNA elongation to the T7 polymerase–thioredoxin complex. On the basis of published crystallographic data, we show that the third DNA strand primer fits within the catalytic centre of the T7 DNA polymerase, thus underlying this new property of several DNA polymerases which may be relevant to genome rearrangements and to the evolution of the genetic apparatus, namely the DNA structure and replication processes.