共查询到20条相似文献,搜索用时 31 毫秒
1.
2.
Kun Wei Zhihe Zhang Wenping Zhang Xiao Xu Xu Liang Guangxin He Fujun Shen Liang Zhang Rong Hou Bisong Yue 《Conservation Genetics》2008,9(1):225-228
An inexpensive, time-saving and reliable method, polymerase chain reaction with confronting two-pair primers (PCR-CTPP), was
developed for sex identification in tiger (Panthera tigris) based on zinc finger alleles (ZFX/ZFY). A site of “C/G” transversion representing fixed differences that discriminated between
ZFX and ZFY exons among felids was identified for primers designing. This primer set was successfully tested on samples including
blood, shed hairs, dried skin, and stool which contained potential contamination caused by prey DNA. Cross species tests shown
that this primer set was also useful for sex identification in four other endangered felids. 相似文献
3.
María A. Blasco José A. Esteban Juan Méndez Luis Blanco Margarita Salas 《Chromosoma》1992,102(Z1):S32-S38
TheBacillus subtilis phage ?29 DNA polymerase, involved in protein-primed viral DNA replication, contains several amino acid consensus sequences
common to other eukaryotic-type DNA polymerases. Using site-directed mutagenesis, we have studied the functional significance
of a C-terminal conserved region, represented by the Lys-X-Tyr (“K-Y”) motif. Single point mutants have been constructed and
the corresponding proteins have been overproduced and characterized. Measurements of the activity of the mutant proteins indicated
that the invariant Lys and Tyr residues play a critical role in DNA polymerization. Interestingly, substitution of the invariant
Lys either by Arg or Thr, produced enzymes with an increased or a largely reduced, respectively, capability to use a protein
as primer, an intrinsic property of TP-priming DNA polymerases. On the other hand, the viral protein p6, which stimulates
initiation of ?29 DNA replication by formation of a nucleoprotein complex at both DNA replication origins, increased (about
5-fold) the insertion fidelity of ?29 DNA polymerase during the formation of the TP-dAMP initiation complex. We propose a
model in which the special strategy to maintain the integrity of the ?29 DNA ends, by means of a “sliding-back” mechanism,
could also contribute to increase the fidelity of ?29 DNA replication. 相似文献
4.
Murat Akkurt Leocir Welter Erika Maul Reinhard Töpfer Eva Zyprian 《Molecular breeding : new strategies in plant improvement》2007,19(2):103-111
Sequence-characterized amplified regions markers (SCARs) were developed from six randomly amplified polymorphic DNA (RAPD)
markers linked to the major QTL region for powdery mildew (Uncinula necator) resistance in a test population derived from the cross of grapevine cultivars “Regent” (resistant) × “Lemberger”(susceptible).
RAPD products were cloned and sequenced. Primer pairs with at least 21 nucleotides primer length were designed. All pairs
were tested in the F1 progeny of “Regent” × “Lemberger”. The SCAR primers resulted in the amplification of specific bands
of expected sizes and were tested in additional genetic resources of resistant and susceptible germplasm. All SCAR primer
pairs resulted in the amplification of specific fragments. Two of the SCAR markers named ScORA7-760 and ScORN3-R produced
amplification products predominantly in resistant individuals and were found to correlate to disease resistance. ScORA7-760,
in particular, is suitable for marker-assisted selection for powdery mildew resistance and to facilitate pyramiding powdery
mildew resistance genes from various sources. 相似文献
5.
Daniel J. Sargent Annalisa Marchese David W. Simpson Werner Howad Felicidad Fernández-Fernández Amparo Monfort Pere Arús Kate M. Evans Kenneth R. Tobutt 《Tree Genetics & Genomes》2009,5(1):133-145
The Rosaceae contains many economically valuable crop genera, including Malus (apple), Fragaria (strawberry), and Prunus (stone fruit). There has been increasing interest in the development of linkage maps for these species, with a view to marker-assisted
selection to assist breeding programs and, recently, in the development of transferable markers to permit syntenic comparisons
of maps of different rosaceous genera. In this investigation, a set of Malus cDNA sequences were downloaded from the European Molecular Biology Laboratory database. The sequences were aligned with homologous
full-length Arabidopsis genomic DNA sequences to identify putative intron–exon junctions and conserved flanking exon sequences. Primer pairs were
designed from the conserved exon sequences flanking predicted intron–exon junctions in the Malus cDNA sequences. These were used to amplify products by polymerase chain reaction from the parents of the Malus mapping progeny “Fiesta” × “Totem.” Eleven loci, representing ten genes (39%), were polymorphic in the “Fiesta” × “Totem”
population and mapped to seven Malus linkage groups. Transferability to other rosaceous genera was high, with primer pairs representing 85% of genes, amplifying
products from Fragaria and primer pairs representing 85% of genes, amplifying products from Prunus genomic DNA. These primers were screened in the Fragaria and Prunus mapping bin sets and 38% of the genes were successfully located on both maps. Analysis of the markers mapped in more than
one rosaceous genus revealed patterns of synteny between genera, while a comparison with the physical positions of homologous
genes on the Arabidopsis genome revealed high sequence conservation but only fragmentary patterns of macrosynteny. 相似文献
6.
Gubernator B Bartoszewski R Kroliczewski J Wildner G Szczepaniak A 《Photosynthesis research》2008,95(1):101-109
Ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco) can be divided into two branches: the “red-like type” of marine
algae and the “green-like type” of cyanobacteria, green algae, and higher plants. We found that the “green-like type” rubisco
from the thermophilic cyanobacterium Thermosynechococcus elongatus has an almost 2-fold higher specificity factor compared with rubiscos of mesophilic cyanobacteria, reaching the values of
higher plants, and simultaneously revealing an improvement in enzyme thermostability. The difference in the activation energies
at the transition stages between the oxygenase and carboxylase reactions for Thermosynechococcus elongatus rubisco is very close to that of Galdieria partita and significantly higher than that of spinach. This is the first characterization of a “green-like type” rubisco from thermophilic
organism. 相似文献
7.
R. Prasad W. A. Beard V. K. Batra Y. Liu D. D. Shock S. H. Wilson 《Molecular Biology》2011,45(4):536-550
The current “working model” for mammalian base excision repair involves two sub-pathways termed single-nucleotide base excision
repair and long patch base excision repair that are distinguished by their repair patch sizes and the enzymes/co-factors involved.
These base excision repair sub-pathways are designed to sequester the various DNA intermediates, passing them along from one
step to the next without allowing these toxic molecules to trigger cell cycle arrest, necrotic cell death, or apoptosis. Although
a variety of DNA-protein and protein-protein interactions are known for the base excision repair intermediates and enzymes/co-factors,
the molecular mechanisms accounting for step-to-step coordination are not well understood. In this review, we explore the
question of whether there is an actual step-to-step “hand-off” of the DNA intermediates during base excision repair in vitro.
The results show that when base excision repair enzymes are pre-bound to the initial single-nucleotide base excision repair
intermediate, the DNA is channeled from apurinic/apyrimidinic endonuclease 1 to DNA polymerase β and then to DNA ligase. In
the long patch base excision repair sub-pathway, where the 5′-end of the incised strand is blocked, the intermediate after
polymerase β gap filling is not channeled from polymerase β to the subsequent enzyme, flap endonuclease 1. Instead, flap endonuclease
1 must recognize and bind to the intermediate in competition with other molecules. 相似文献
8.
Patrick J. Venta James A. Brouillette Vilma Yuzbasiyan-Gurkan George J. Brewer 《Biochemical genetics》1996,34(7-8):321-341
We are developing a genetic map of the dog based partly upon markers contained within known genes. In order to facilitate
the development of these markers, we have used polymerase chain reaction (PCR) primers designed to conserved regions of genes
that have been sequenced in at least two species. We have refined the method for designing primers to maximize the number
that produce successful amplifications across as many mammalian species as possible. We report the development of primer sets
for 11 loci in detail:CFTR, COL10A1, CSFIR, CYP1A1, DCN1, FES, GHR, GLB1, PKLR, PVALB, andRB1. We also report an additional 75 primer sets in the appendices. The PCR products were sequenced to show that the primers
amplify the expected canine genes. These primer sets thus define a class of gene-specific sequence-tagged sites (STSs). There
are a number of uses for these STSs, including the rapid development of various linkage tools and the rapid testing of genomic
and cDNA libraries for the presence of their corresponding genes. Six of the eleven gene targets reported in detail have been
proposed to serve as “anchored reference loci” for the development of mammalian genetic maps [O'Brien, S. J.,et al., Nat. Genet.
3:103, 1993]. The primer sets should cover a significant portion of the canine genome for the development of a linkage map.
In order to determine how useful these primer sets would be for the other genome projects, we tested the 11 primer sets on
the DNA from species representing five mammalian orders. Eighty-four percent of the gene-species combinations amplified successfully.
We have named these primer sets “universal mammalian sequence-tagged sites” because they should be useful for many mammalian
genome projects. 相似文献
9.
The simultaneous operation of paired, opposing reactions (substrate cycles) or parallel reactions (dual pathways) with seeming
wastage of ATP is widespread in cellular metabolism. Analysis of such “futile” pathways has hitherto been limited to loci
with only two or three interconnecting fluxes. We introduce here a method that allows straightforward analysis of more complex
systems. The method involves the linear superposition of “fundamental” modes, one or more of which may be energetically wasteful.
Decomposition of a flux pattern into such modes allows computation of the amount of free energy “wasted” at any locus. Appropriate
normalizations of energy wastage yield a number of indices useful for assessing the energetic impact of futile pathways on
the cell and for comparing the degree of regulation of substrate cycles or dual pathways under different metabolic conditions.
This approach is applied to steady-state flux data obtained in the protozoanTetrahymena pyriformis and in isolated rat hepatocytes under a variety of conditions. 相似文献
10.
A method for the in vitro selection of mutant DNA has been devised as an adjunct to the recently developed method for the use of short enzymatically-synthesized oligodeoxyribonucleotides of defined sequence as sitespecific mutagens for circular DNA. The selection method uses the mutating oligodeoxyribonucleotide as a primer for Escherichia coli DNA polymerase I (large fragment) under conditions where there is preferential interaction with mutant DNA template. After ligation using T4 DNA ligase, endonuclease Sl is used to degrade single-stranded non-mutant DNA leaving the desired mutant as closed circular duplex DNA. This paper describes the development of the method using mutants in ØX174 DNA as the model system. Studies on the changes A → G and G → A at position 587 of ØX174 viral DNA (am 3 to wild-type and its reversal) show that one or two cycles of selection can lead to a population of phage consisting of close to 100% mutants. 相似文献
11.
Leptospirillum ferriphilum has been identified as the dominant, moderately thermophilic, bioleaching microorganism in bioleaching processes. It is an
acidic and chemolithoautrophic bacterium that gains electrons from ferrous iron oxidation for energy production and cell growth.
Genetic information about this microorganism has been limited until now, which has hindered its further exploration. In this
study, the complete genome of L. ferripilum ML-04 is sequenced and annotated. The bacterium has a single circular chromosome of 2,406,157 bp containing 2,471 coding
sequences (CDS), 2 rRNA operons, 48 tRNA genes, a large number of mobile genetic elements and 2 genomic islands. In silico analysis shows L. ferriphilum ML-04 fixes carbon through a reductive citric acid (rTCA) cycle, and obtains nitrogen through ammonium assimilation. The
genes related to “cell envelope biogenesis, outer membrane” (6.9%) and “DNA replication, recombination and repair” (5.6%)
are abundant, and a large number of genes related to heavy metal detoxification, oxidative and acidic stress defense, and
signal transduction pathways were detected. The genomic plasticity, plentiful cell envelope components, inorganic element
metabolic abilities and stress response mechanisms found the base for this organism’s survival in the bioleaching niche. 相似文献
12.
13.
We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed. 相似文献
14.
15.
16.
Dael S. Williamson Kyle C. Dent Brandon W. Weber Arvind Varsani Joni Frederick Robert N. Thuku Rory A. Cameron Johan H. van Heerden Donald A. Cowan B. Trevor Sewell 《Applied microbiology and biotechnology》2010,88(1):143-153
Geobacillus pallidus RAPc8 (NRRL: B-59396) is a moderately thermophilic gram-positive bacterium, originally isolated from Australian lake sediment.
The G. pallidus RAPc8 gene encoding an inducible nitrilase was located and cloned using degenerate primers coding for well-conserved nitrilase
sequences, coupled with inverse PCR. The nitrilase open reading frame was cloned into an expression plasmid and the expressed
recombinant enzyme purified and characterized. The protein had a monomer molecular weight of 35,790 Da, and the purified functional
enzyme had an apparent molecular weight of ~600 kDa by size exclusion chromatography. Similar to several plant nitrilases
and some bacterial nitrilases, the recombinant G. pallidus RAPc8 enzyme produced both acid and amide products from nitrile substrates. The ratios of acid to amide produced from the
substrates we tested are significantly different to those reported for other enzymes, and this has implications for our understanding
of the mechanism of the nitrilases which may assist with rational design of these enzymes. Electron microscopy and image classification
showed complexes having crescent-like, “c-shaped”, circular and “figure-8” shapes. Protein models suggested that the various
complexes were composed of 6, 8, 10 and 20 subunits, respectively. 相似文献
17.
A novel simple and rapid PCR-based site-directed mutagenesis method 总被引:11,自引:0,他引:11
Rabhi I Guedel N Chouk I Zerria K Barbouche MR Dellagi K Fathallah DM 《Molecular biotechnology》2004,26(1):27-34
Site-directed mutagenesis (SDM) is a powerful tool for exploring protein structure and function, and several procedures adjusted
to specific purposes are still being developed. Herein we describe a straightforward and efficient method with versatile applications
for introducing site-specific alterations in any deoxyribonucleic acid (DNA) sequence cloned in a plasmidic expression vector.
In this polymerase chain reaction (PCR)-based SDM method, forward and reverse primers are used to amplify the plasmid containing
the sequence of interest. The primers are designed so that the desired modifications are introduced at the 5′ end of one of
the primers, whereas the other primer starts with the nucleotide at position (−1) of the one to be modified. The PCR is carried
out using Pfu DNA polymerase. The blunt-ended PCR-generated DNA fragment is self-ligated and used to transform Escherichia coli. Mutant clones are screened by colony hybridization using the mutagenic primer as probe and the presence of the mutation
is confirmed by direct DNA sequencing. This procedure was used efficiently to introduce substitutions, deletions, and insertions
in the DNA sequences coding for a recombinant form (scFv) of antibody 107 specific of the human CR3 molecule, the rat α integrin
CD11b A-domain and the human CD8β cloned in pPICZαB, pGEX-2T, and CDM8 expression vectors, respectively. 相似文献
18.
C. Dall’Asta S. Sforza A. Moseriti G. Galaverna A. Dossena R. Marchelli 《Mycotoxin Research》2005,21(4):218-223
Zearalenone is a mycotoxin mainly produced by severalFusarium species, which are known to colonize grains in temperate climates. The purpose of the study is to provide a reliable isotope
dilution method for the quantification of this mycotoxin. A derivative of the analyte to be used as standard is obtained by
reaction with acetic anhydride, which is available in two pure isotopic forms, a protonated (“light”) and a hexadeuterated
(“heavy”). The derivatized standards are added to the matrix split intwo parts. Then, the derivatization procedure is repeated
on both matrices derivatizing the part containing the “heavy” labelled standard with the “light” acetic anhydride and the
part containing the “light” labelled standard with the “heavy” acetic anhydride. Both extracted mixtures are analyzed by LC/MS,
monitoring the “light” and the “heavy” labelled analytes and using the former as standard for the latter in one case and viceversa
in the other case. The method allowed to obtain very good results, without the need of IAC purification.
Presented at the 27th Mykotoxin-Workshop, Dortmund, Germany, June 13–15, 2005.
Financial support: The Italian Ministry of Health 相似文献
19.
Kenichi Ohara Momoko Hotta Daisuke Takahashi Takashi Asahida Hitoshi Ida Tetsuya Umino 《Ichthyological Research》2009,56(4):373-379
The genetic diversity and relationship among four morphotypes of Rhinogobius sp. OR, Gobiidae (“Tōshoku,” “Shinjiko,” “Gi-tōshoku,” and “Shimahire”) were investigated with seven microsatellite DNA loci,
and amphidromy of these morphotypes was verified by strontium (Sr) and calcium (Ca) deposition in the otolith. Samples of
“Tōshoku,” “Shinjiko,” “Gi-tōshoku,” and “Shimahire” were collected from, respectively, three, three, two, and four locations
in Japan. Microsatellite analysis detected high genetic diversity (based on the number of alleles, allelic richness, and average
observed heterozygosity) in the “Tōshoku” and “Shinjiko” morphotypes relative to the “Shimahire” morphotype; the “Gi-tōshoku”
morphotype had an intermediate level of variation. Almost all pairwise F
ST values were significantly different from zero (P < 0.001), except between two populations of “Tōshoku.” Clear genetic independence was observed between the “Shinjiko” and
“Shimahire” morphotypes in the Maruyama River. A principle component analysis based on microsatellite data indicated that
the “Tōshoku,” “Shinjiko,” and “Gi-tōshoku” morphotypes were genetically similar. Furthermore, the three populations of “Tōshoku”
were closely related each other, and two of those collected from the Lake Biwa system were a single population. There was,
however, a high degree of genetic differentiation between “Shimahire” and the other morphotypes; moreover, there was high
genetic divergence among four populations of the “Shimahire” morphotype. Amphidromous migratory histories were indicated by
Sr:Ca ratios in two of three populations of the “Shinjiko” morphotype and in one of two “Gi-tōshoku” morphotypes, whereas
all populations of the “Shimahire” morphotype were freshwater residents. The large genetic divergence and low genetic diversity
in “Shimahire” are likely related to migration history. 相似文献
20.
“Bacillus thermoantarcticus” sp. nov., from Mount Melbourne,Antarctica: a novel thermophilic species
B. Nicolaus Licia Lama Enrico Esposito Maria Cristina Manca Guido di Prisco Agata Gambacorta 《Polar Biology》1996,16(2):101-104
A novel thermophilic Gram-positive bacillus, “Bacillus thermoantarcticus”, isolated from geothermal soil near the crater of Mount Melbourne, is described. The organism grows at an optimal temperature
of 63°C at pH 6.0, is oxidase-positive, catalase-negative and produces an exopolysaccharide, an exocellular xylanase, an intracellular
alcohol dehydrogenase and exo- and endocellular α-glucosidase(s). The sequence of 16S rDNA is very similar to that of “Bacillus thermoglucosidasius”; however, the guanine-plus-cytosine (G+C) content is 8 mol% higher. The type strain is “Bacillus thermoantarcticus” (DSM 9572).
Received : 3 February 1995/Accepted : 12 May 1995 相似文献