A Genetically Distinct Form of Cyclic Amp Phosphodiesterase Associated with Chromomere 3d4 in DROSOPHILA MELANOGASTER

Two cyclic AMP phosphodiesterase enzymes (E.C.3.1.4.17) are present in homogenates of adult Drosophila melanogaster. The two enzymes differ from one another in heat stability, affinity for Mg++, Ca++ activation and molecular weight. They do not differ markedly in their affinities for cyclic AMP, and both exhibit anomalous Michaelis-Menten kinetics. The more heat-labile enzyme is controlled in a dosage-dependent manner by chromomere 3D4 of the X chromosome and is absent in flies that are deficient for chromomere 3D4. Chromomere 3D4 is also necessary for the maintenance of normal cAMP levels, for male fertility, and for normal female fertility and oogenesis. The structural gene(s) for the more heat-stable enzyme is located outside of chromomeres 3C12-3D4. Whether 3D4 contains a structural gene, or a regulatory gene necessary for the presence of the labile enzyme, remains to be determined.     

Genetic Analysis of Chromomere 3d4 in DROSOPHILA MELANOGASTER: The DUNCE and SPERM-AMOTILE Genes

Both male and female Drosophila that are homozygous deficient for chromomere 3D4 are viable but sterile and lack detectable cAMP-specific phosphodiesterase activity. Two genes have been localized to this region: spermamotile (sam) and dunce (dnc). The sperm-amotile gene is required for male fertility, and the dunce gene is required for normal learning, female fertility, and cAMP-specific phosphodiesterase activity. The sperm-amotile gene maps 0.24 map units to the left of dunce. The expression of the dunce gene seems to be affected by a chromosomal break to the left of sperm-amotile. The fertility of dunce females varies according to changes in the genetic background and the presence or absence of an X-linked suppressor.     

Genetic manipulation of cyclic AMP levels in Drosophila melanogaster.

Cyclic AMP levels in $\text{Drosophila}$,$\text{melanogaster}$ adults can be altered genetically by changing the number of doses of chromomere 3D4 contained in the genome, a chromomere previously shown to control the activity of cyclic AMP phosphodiesterase in a dose-dependent manner. Flies completely deficient for chromomere 3D4 have 2–7 times the cyclic AMP level of flies with one or two doses of chromomere 3D4. Cyclic AMP levels are significantly depressed in flies carrying three doses of 3D4. Cyclic GMP levels are not influenced in a dose-dependent manner by chromomere 3D4. The effect on cyclic AMP levels may provide a useful system for investigating physiological and developmental consequences of aberrant cyclic AMP levels in the intact organism.     

Ndel1 alters its conformation by sequestering cAMP-specific phosphodiesterase-4D3 (PDE4D3) in a manner that is dynamically regulated through Protein Kinase A (PKA)

The involvement of the Nuclear distribution element-like (Ndel1; Nudel) protein in the recruitment of the dynein complex is critical for neurodevelopment and potentially important for neuronal disease states. The PDE4 family of phosphodiesterases specifically degrades cAMP, an important second messenger implicated in learning and memory functions. Here we show for the first time that Ndel1 can interact directly with PDE4 family members and that the interaction of Ndel1 with the PDE4D3 isoform is uniquely disrupted by elevation of intracellular cAMP levels. While all long PDE4 isoforms are subject to stimulatory PKA phosphorylation within their conserved regulatory UCR1 domain, specificity for release of PDE4D3 is conferred due to the PKA-dependent phosphorylation of Ser13 within the isoform-specific, unique amino-terminal domain of PDE4D3. Scanning peptide array analyses identify a common region on Ndel1 for PDE4 binding and an additional region that is unique to PDE4D3. The common site lies within the stutter region that links the second coiled-coil region to the unstable third coiled-coil regions of Ndel1. The additional binding region unique to PDE4D3 penetrates into the start of the third coiled-coil region that can undergo tail-to-tail interactions between Ndel1 dimers to form a 4 helix bundle. We demonstrate Ndel1 self-interaction in living cells using a BRET approach with luciferase- and GFP-tagged forms of Ndel1. BRET assessed Ndel1–Ndel1 self-interaction is amplified through the binding of PDE4 isoforms. For PDE4D3 this effect is ablated upon elevation of intracellular cAMP due to PKA-mediated phosphorylation at Ser13, while the potentiating effects of PDE4B1 and PDE4D5 are resistant to cAMP elevation. PDE4D long isoforms and Ndel1 show a similar sub-cellular distribution in hippocampus and cortex and locate to post-synaptic densities. We show that Ndel1 sequesters EPAC, but not PKA, in order to form a cAMP signalling complex. We propose that a key function of the Ndel1 signalling scaffold is to signal through cAMP by sequestering EPAC, whose activity may thus be specifically regulated by sequestered PDE4 that also stabilizes Ndel1–Ndel1 self-interaction. In the case of PDE4D3, its association with Ndel1 is dynamically regulated by PKA input through its ability to phosphorylate Ser13 in the unique N-terminal region of this isoform, triggering the specific release of PDE4D3 from Ndel1 when cAMP levels are elevated. We propose that Ser13 may act as a redistribution trigger in PDE4D3, allowing it to dynamically re-shape cAMP gradients in distinct intracellular locales upon its phosphorylation by PKA.     

The Anatomy and Function of a Segment of the X Chromosome of DROSOPHILA MELANOGASTER

An average size chromomere of the polytene X chromosome of Drosophila melanogaster contains enough DNA in each haploid equivalent strand to code for 30 genes, each 1,000 nucleotides long. We have attempted to learn about the organization of chromosomes by asking how many functional units can be localized within a chromomere. This was done by 1) recovery of mutants representative of every cistron in the 3A2-3C2 region; 2) the characterization of the function of each mutant type and grouping by complementation tests; 3) the determination of the genetic and cytological position of each cistron by recombination and deletion mapping. The data clearly show one functional group per chromomere. It is postulated that a chromomere is one cistron within which much of the DNA is regulatory in function.     

A Cytogenetic Analysis of Cyclic Nucleotide Phosphodiesterase Activities in Drosophila

The genome of Drosophila melanogaster has been surveyed for chromosomal regions which exert a dosage effect on the activities of cAMP phosphodiesterase or cGMP phosphodiesterase. Two regions increase cAMP phosphodiesterase activity when present as duplications. A region of the X chromosome increases cAMP phosphodiesterase activity when duplicated and decreases that activity when deficient. This region has been delimited to chromomeres 3D3 and 3D4, with 3D4 being the most probable locus, and may contain a structural gene for cAMP phosphodiesterase. A region on the third chromosome, 90E-91B, increases cAMP phosphodiesterase activity when duplicated but has no effect on the activity when deficient. Two regions increase cGMP phosphodiesterase activity when present as duplications. A region of the X chromosome, 5D-9C, increases cGMP phosphodiesterase activity when duplicated, but smaller duplications covering this region fail to show such an increase, indicating that a single locus is not responsible for the increase observed for the larger duplication. A region of the third chromosome, 88C-91B, also increases cGMP phosphodiesterase activity when duplicated. Smaller duplications covering this region show smaller increases than that observed for the larger duplication, suggesting that at least three loci between 88C and 91B contribute to the observed increase by that region. Deficiencies covering region 88C-91B do not affect cGMP phosphodiesterase activity. No locus for a presumptive structural gene for cGMP phosphodiesterase has been found. Limitations of the use of segmental aneuploidy in locating structural genes for enzymes are discussed.     

Phosphodiesterase 4D and protein kinase a type II constitute a signaling unit in the centrosomal area

The mediation of cAMP effects by specific pools of protein kinase A (PKA) targeted to distinct subcellular domains raises the question of how inactivation of the cAMP signal is achieved locally and whether similar targeting of phosphodiesterases (PDEs) to sites of cAMP/PKA action could be observed. Here, we demonstrate that Sertoli cells of the testis contain an insoluble PDE4D3 isoform, which is shown by immunofluorescence to target to centrosomes. Staining of PDE4D and PKA shows co-localization of PDE4D with PKA-RIIalpha and RIIbeta in the centrosomal region. Co-precipitation of RII subunits and PDE4D3 from cytoskeletal extracts indicates a physical association of the two proteins. Distribution of PDE4D overlaps with that of the centrosomal PKA-anchoring protein, AKAP450, and AKAP450, PDE4D3, and PKA-RIIalpha co-immunoprecipitate. Finally, both PDE4D3 and PKA co-precipitate with a soluble fragment of AKAP450 encompassing amino acids 1710 to 2872 when co-expressed in 293T cells. Thus, a centrosomal complex that includes PDE4D and PKA constitutes a novel signaling unit that may provide accurate spatio-temporal modulation of cAMP signals.     

The cAMP-specific phosphodiesterase PDE4D3 is regulated by phosphatidic acid binding. Consequences for cAMP signaling pathway and characterization of a phosphatidic acid binding site

Hormones and growth factors induce in many cell types the production of phosphatidic acid (PA), which has been proposed to play a role as a second messenger. We have previously shown in an acellular system that PA selectively stimulates certain isoforms of type 4 cAMP-phosphodiesterases (PDE4). Here we studied the effect of endogenous PA on PDE activity of transiently transfected MA10 cells overexpressing the PA-sensitive isoform PDE4D3. Cell treatment with inhibitors of PA degradation, including propranolol, induced an accumulation of endogenous PA accompanied by a stimulation of PDE activity and a significant decrease in both cAMP levels and protein kinase A activity. Furthermore, in FRTL5 cells, which natively express PDE4D3, pretreatment with compounds inducing PA accumulation prevented both cAMP increase and cAMP-responsive element-binding protein phosphorylation triggered by thyroid-stimulating hormone. To determine the mechanism of PDE stimulation by PA, endogenous phospholipids were labeled by preincubating MA10 cells overexpressing PDE4D3 with [(32)P]orthophosphate. Immuno- precipitation experiments showed that PA was specifically bound to PDE4D3, supporting the hypothesis that PDE4D3 activation occurs through direct binding of PA to the protein. PA binding site on PDE4D3 was characterized by engineering deletions of selected regions in the N-terminal regulatory domain of the enzyme. Deletion of amino acid residues 31-59 suppressed both PA-activating effect and PA binding, suggesting that this region rich in basic and hydrophobic residues contains the PA binding site. These observations strongly suggest that endogenous PA can modulate cAMP levels in intact cells, through a direct activation of PDE4D3.     

Phosphodiesterase regulation is critical for the differentiation and pattern of gene expression in granulosa cells of the ovarian follicle

Feedback regulations are integral components of the cAMP signaling required for most cellular processes, including gene expression and cell differentiation. Here, we provide evidence that one of these feedback regulations involving the cyclic nucleotide phosphodiesterase PDE4D plays a critical role in cAMP signaling during the differentiation of granulosa cells of the ovarian follicle. Gonadotropins induce PDE4D mRNA and increase the cAMP hydrolyzing activity in granulosa cells, demonstrating that a feedback regulation of cAMP is operating in granulosa cells in vivo. Inactivation of the PDE4D by homologous recombination is associated with an altered pattern of cAMP accumulation induced by the gonadotropin LH/human chorionic gonadotropin (hCG), impaired female fertility, and a markedly decreased ovulation rate. In spite of a disruption of the cAMP response, LH/hCG induced P450 side chain cleavage expression and steroidogenesis in a manner similar to wild-type controls. Morphological examination of the ovary of PDE4D-/- mice indicated luteinization of antral follicles with entrapped oocytes. Consistent with the morphological finding of unruptured follicles, LH/hCG induction of genes involved in ovulation, including cyclooxygenase-2, progesterone receptor, and the downstream genes, is markedly decreased in the PDE4D-/- ovaries. These data demonstrate that PDE4D regulation plays a critical role in gonadotropin mechanism of action and suggest that the intensity and duration of the cAMP signal defines the pattern of gene expression during the differentiation of granulosa cells.     

The use of bridging systems to increase genetic variability in compound chromosome strains for genetic control of Lucilia cuprina (Wiedemann)

Summary Genetic variability in the non-compound portion of the genomes of compound-chromosome (CC) strains intended for genetic control can be increased by the use of bridging strains which can be crossed to both CC and normal strains. Two bridging systems are described for chromosome-5 CC strains of Lucilia cuprina. The first system relies on the established viability and fertility of males trisomic for chromosome 5R. Males carrying the (5L.YL)23 half-translocation, a C(5R), and a normal chromosome 5 were crossed successfully to a CC strain and a normal strain. The second system uses a pair of reciprocal whole-arm 4;5 translocations to generate gametes disomic for 5R and nullosomic for 5L, which in combination with C(5L)-bearing gametes form viable near-euploid offspring with only small duplications and deficiencies. These offspring (C(5L); (4L.5R)357; (4R.5R)194; (4L.4R)) were crossed successfully with both CC and T(4;5)357/ + individuals. The latter were in turn crossed successfully with normal strains. The T(Y;5)23 system allows replacement of the non-CC genome with wild material more rapidly than the T(4;5)357/T(4;5)194 system, but unlike the latter does not allow replacement of the Y chromosome in the CC strain. The double translocation system is currently being used in L. cuprina.     

Catsper3 and catsper4 encode two cation channel-like proteins exclusively expressed in the testis

CATSPER1 and CATSPER2 are two cation channel-like proteins exclusively expressed in the testis and essential for normal sperm motility and male fertility. Using in silico subtraction and database mining, we identified expressed sequence tags encoding two previously uncharacterized cation channel-like proteins structurally homologous to CATSPER1 and CATSPER2. Similar to CATSPER1 and CATSPER2, these two proteins contain a single-ion transport domain comprised of six transmembrane spanning regions, in which the fourth transmembrane region resembles a voltage sensor and a pore-forming region lies between transmembrane regions 5 and 6. The pore contains the consensus sequence T x D x W, which is indicative of a potential calcium-selective channel. The mRNAs for Catsper3 and Catsper4 were detected exclusively in the testis using multitissue Northern blot and RT-PCR analyses. The onsets of both genes coincide with the first appearance of spermatids during testicular development. In situ hybridization analyses revealed that Catsper3 and Catsper4 mRNAs displayed identical localization patterns and were confined to spermatids of steps 1-8. Immunofluorescence and immunohistochemistry analyses demonstrated that these two proteins were expressed within the acrosome of late spermatids and spermatozoa. Our data suggest that CATSPER3 and CATSPER4 are two cation-channel proteins and have roles in acrosome reaction and male fertility.     

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)     

Lethality Patterns and Morphology of Selected Lethal and Semi-Lethal Mutations in the Zeste-White Region of DROSOPHILA MELANOGASTER

Aspects of the developmental genetics of lethal and semi-lethal mutants representing 13 complementation groups (cistrons) in the 3A-3C region of the X chromosome of Drosophila melanogaster are given. Each of these cistrons is associated with a particular chromomere in the salivary gland chromosome. Mutants within each cistron have similar lethality patterns and morphological attributes, and the characteristics of a given cistron are distinct with respect to other cistrons. These results provide additional evidence that only one function is associated with each chromomere.-The results of the lethality pattern analysis are also compared with previous studies of lethal mutants of Drosophila.     

Cyclic AMP inhibits the proliferation of thyroid carcinoma cell lines through regulation of CDK4 phosphorylation

How cyclic AMP (cAMP) could positively or negatively regulate G1 phase progression in different cell types or in cancer cells versus normal differentiated counterparts has remained an intriguing question for decades. At variance with the cAMP-dependent mitogenesis of normal thyroid epithelial cells, we show here that cAMP and cAMP-dependent protein kinase activation inhibit S-phase entry in four thyroid carcinoma cell lines that harbor a permanent activation of the Raf/ERK pathway by different oncogenes. Only in Ret/PTC1-positive TPC-1 cells did cAMP markedly inhibit the Raf/ERK cascade, leading to mTOR pathway inhibition, repression of cyclin D1 and p21 and p27 accumulation. p27 knockdown did not prevent the DNA synthesis inhibition. In the other cells, cAMP little affected these signaling cascades and levels of cyclins D or CDK inhibitors. However, cAMP differentially inhibited the pRb-kinase activity and T172-phosphorylation of CDK4 complexed to cyclin D1 or cyclin D3, whereas CDK-activating kinase activity remained unaffected. At variance with current conceptions, our studies in thyroid carcinoma cell lines and previously in normal thyrocytes identify the activating phosphorylation of CDK4 as a common target of opposite cell cycle regulations by cAMP, irrespective of its impact on classical mitogenic signaling cascades and expression of CDK4 regulatory partners.     

Gprk2 controls cAMP levels in Drosophila development

G protein-coupled receptors mediate their biological responses through the generation of second messengers, such as cAMP. The down-regulation of their activity (desensitization) is carried out, in part, by the family of G protein-coupled receptor kinases, which phosphorylate activated receptors. The Gprk2 gene in Drosophila melanogaster is a putative member of this family. The GPRK2 protein is expressed most abundantly in the ovaries and in the mushroom bodies, the brain region that is implicated in learning and memory in insects. Many of the genes that are involved in learning in Drosophila are members of a cAMP-signaling pathway and are also expressed in the mushroom bodies. These observations suggest that the Gprk2 gene may be involved in a cAMP-mediated pathway. To investigate this possibility, we tested for a genetic interaction between Gprk2 and dunce (which encodes cAMP-specific phosphodiesterase). A mutant allele of Gprk2, called gprk2(6936), has decreased fertility as a result of reduced levels of egg laying and hatching, and developing egg chambers display defects in the formation of anterior structures. Similarly, many alleles of dunce are sterile, with an ovary phenotype that resembles gprk2(6936). Introduction of a single copy of a hypomorphic or null allele of dunce into the gprk2(6936) background suppressed all of these defects to a significant degree. Suppression was also observed when a single copy of gprk2(6936) was introduced into a dunce background. Like mutants of rutabaga (which encodes a calcium/calmodulin-dependent adenylate cyclase), gprk2(6936) has reduced levels of cAMP. Ovaries from gprk2(6936) females contain about one third of the normal amount of cAMP. In addition, in every mutant combination where fertility is increased, cAMP levels are closer to wild type levels. These results suggest that Gprk2 is functioning in a cAMP-signaling pathway and that the underlying basis of the interaction between Gprk2 and dunce is a normalization of cAMP levels.     

Evolution of self-organisation in Dictyostelia by adaptation of a non-selective phosphodiesterase and a matrix component for regulated cAMP degradation

Dictyostelium discoideum amoebas coordinate aggregation and morphogenesis by secreting cyclic adenosine monophosphate (cAMP) pulses that propagate as waves through fields of cells and multicellular structures. To retrace how this mechanism for self-organisation evolved, we studied the origin of the cAMP phosphodiesterase PdsA and its inhibitor PdiA, which are essential for cAMP wave propagation. D. discoideum and other species that use cAMP to aggregate reside in group 4 of the four major groups of Dictyostelia. We found that groups 1-3 express a non-specific, low affinity orthologue of PdsA, which gained cAMP selectivity and increased 200-fold in affinity in group 4. A low affinity group 3 PdsA only partially restored aggregation of a D. discoideum pdsA-null mutant, but was more effective at restoring fruiting body morphogenesis. Deletion of a group 2 PdsA gene resulted in disruption of fruiting body morphogenesis, but left aggregation unaffected. Together, these results show that groups 1-3 use a low affinity PdsA for morphogenesis that is neither suited nor required for aggregation. PdiA belongs to a family of matrix proteins that are present in all Dictyostelia and consist mainly of cysteine-rich repeats. However, in its current form with several extensively modified repeats, PdiA is only present in group 4. PdiA is essential for initiating spiral cAMP waves, which, by organising large territories, generate the large fruiting structures that characterise group 4. We conclude that efficient cAMP-mediated aggregation in group 4 evolved by recruitment and adaptation of a non-selective phosphodiesterase and a matrix component into a system for regulated cAMP degradation.