Cloning and characterization of additional members of the G protein-coupled receptor family

A search of the expressed sequence tag (EST) database retrieved a human cDNA sequence which partially encoded a novel G protein-coupled receptor (GPCR) GPR26. A human genomic DNA fragment encoding a partial open reading frame (ORF) and a rat cDNA encoding the full length ORF of GPR26 were obtained by library screening. The rat GPR26 cDNA encoded a protein of 317 amino acids, most similar (albeit distantly related) to the serotonin 5-HT(5A) and gastrin releasing hormone BB2 receptors. GPR26 mRNA expression analysis revealed signals in the striatum, pons, cerebellum and cortex. HEK293 and Rh7777 cells transfected with GPR26 cDNA displayed high basal cAMP levels, slow growth rate of clonal populations and derangements of normal cell shape. We also used a sequence reported only in the patent literature encoding GPR57 (a.k.a. HNHCI32) to PCR amplify a DNA fragment which was used to screen a human genomic library. This resulted in the cloning of a genomic fragment containing a pseudogene, psiGPR57, with a 99.6% nucleotide identity to GPR57. Based on shared sequence identities, the receptor encoded by GPR57 was predicted to belong to a novel subfamily of GPCRs together with GPR58 (a.k.a. phBL5, reported only in the patent literature), putative neurotransmitter receptor (PNR) and a 5-HT(4) pseudogene. Analysis of this subfamily revealed greatest identities (approximately 56%) between the receptors encoded by GPR57 and GPR58, each with shared identities of approximately 40% with PNR. Furthermore, psiGPR57, GPR58, PNR and the 5-HT(4) pseudogene were mapped in a cluster localized to chromosome 6q22-24. PNR and GPR58 were expressed in COS cells, however no specific binding was observed for various serotonin receptor-specific ligands.     

Gene structure and nucleotide sequence for rat cytochrome P-450c

Two clones from rat genomic libraries that contain the entire gene for rat cytochrome P-450c have been isolated. lambda MC4, the first clone isolated from an EcoR1 library, contained a 14-kb insert. A single 5.5-kb EcoR1 fragment from lambda MC4, the EcoR1 A fragment, hybridized to a partial cDNA clone for the 3' end of the cytochrome P-450c mRNA. This fragment was sequenced using the dideoxynucleotide chain termination methodology with recombinant M13 bacteriophage templates. Comparison of this sequence with the complete cDNA sequence of cytochrome P-450MC [Yabusaki et al. (1984) Nucleic. Acids Res. 12, 2929-2938] revealed that the EcoR1 A fragment contained the entire cytochrome P-450c gene with the exception of a 90-bp leader sequence. The gene sequence is in perfect agreement with the cDNA sequence except for two bases in exon 2. A second genomic clone, lambda MC10, which was isolated from a HaeIII library, contains the missing leading sequence as well as 5' regulatory sequences. The entire gene is about 6.1 kb in length with seven exons separated by six introns, all of the intron/exon junctions being defined by GT/AG. Amino- and carboxy-terminal information are contained in exons 2 and 7, respectively. These exons contain the highly conserved DNA sequences that have been observed in other cytochrome P-450 species. Potential regulatory sequences have been located both 5' to the gene as well as within intron I. A comparison of the coding information for cytochrome P-450c with the sequence of murine cytochrome P3-450 and rat cytochrome P-450d revealed a 70% homology in both the DNA and amino acid sequence, suggesting a common ancestral gene. Genomic blot analyses of rat DNA indicated that the 3-methylcholanthrene-inducible family of cytochrome P-450 isozymes is more limited in number compared to the phenobarbital-inducible isozymes. Cross-hybridization studies with human DNA suggest a high degree of conservation between rat cytochrome P-450c and its human homolog although gross structural differences do exist between the two genes.     

Identification of a Ferritin Light Chain Pseudogene Near the Glycerol Kinase Locus in Xp21 by cDNA Amplification for Identification of Genomic Expressed Sequences

We used cDNA amplification for identification of genomic expressed sequences (CAIGES) to identify genes in the glycerol kinase region of the human X chromosome. During these investigations we identified the sequence for a ferritin light chain (FTL) pseudogene in this portion of Xp21. A human liver cDNA library was amplified by vector primers, labeled, and hybridized to Southern blots ofEcoRIdigested human genomic DNA from cosmids isolated from yeast artificial chromosomes in the glycerol kinase region of Xp21. A 3.1-kb restriction fragment hybridized with the cDNA library, was subcloned and sequenced, and a 440-bp intronless sequence was found with strong similarity to the FTL coding sequence. Therefore, the FTL pseudogene that had been mapped previously to Xp22.3–21.2 was localized specifically to the glycerol kinase region. The CAIGES method permits rapid screening of genomic material and will identify genomic sequences with similarities to genes expressed in the cDNA library used to probe the cloned genomic DNA, including pseudogenes.     

Dictyostelium annexin VII (synexin). cDNA sequence and isolation of a gene disruption mutant.

By cloning the cDNA coding for the membrane associated actin-binding protein p24, we identified a repetitive sequence motif consisting of the amino acids Gly, Tyr, Pro, Gln which is characteristic for a gene family in Dictyostelium discoideum. Using a cDNA probe corresponding to this motif, we isolated cDNA clones coding for a protein of the annexin family. On the basis of a long NH2-terminal sequence encompassing the Gly/Tyr/Pro/Gln motifs, the Dictyostelium annexin was identified as a homolog of vertebrate annexin VII (synexin). The mRNA coding for the Dictyostelium annexin VII has a size of 1.6 kilobases and is present during all developmental stages. Annexin VII is coded for by a single gene in Dictyostelium. A mutant deficient in annexin VII was isolated using a vector which carried the amino-terminal third of the Dictyostelium annexin VII cDNA followed by a viral epitope specific for a monoclonal antibody and a stop codon. Using this approach, homologous recombination in the annexin VII gene led to an expression of the viral epitope under the control of the endogenous annexin VII promoter. Lack of annexin VII is not a lethal event for D. discoideum, and the cells are able to undergo development on agar plates.     

Human gastric intrinsic factor: characterization of cDNA and genomic clones and localization to human chromosome 11

A human gastric intrinsic factor (IF) cDNA clone was isolated using a rat cDNA clone as a probe. Comparison of the predicted amino acid sequence revealed 80% identity of human IF with rat IF. These cDNA clones were used to isolate and map two overlapping clones encoding the human IF gene. The first exon of the cloned region (exon 2) contains 30 bp of the 5' untranslated region, the signal peptide, and the first 8 amino acids of the mature protein. Exons 3-10 encode the remainder of the coding and 3' noncoding regions. Southern analysis of genomic DNA indicated the presence of a single human IF gene and also revealed the presence of strong hybridizing sequences in genomic DNA from monkey, rat, mouse, cow, and human, suggesting that the IF gene is well conserved. The IF gene was localized to human chromosome 11 by concurrent cytogenetic and cDNA probe analysis of a panel of human X mouse somatic cell hybrids. Southern analysis of genomic DNA from patients with congenital pernicious anemia (lacking intrinsic factor) revealed normal restriction fragment patterns, suggesting that a sizable gene deletion was not responsible for the deficiency.     

A cluster of alpha 2-macroglobulin-related genes (alpha 2 M) on human chromosome 12p: cloning of the pregnancy-zone protein gene and an alpha 2M pseudogene

The characterization of two alpha 2-macroglobulin (alpha 2M)-related genomic clones, isolated from two human genomic libraries by use of alpha 2M cDNA [Kan et al., Proc. Natl. Acad. Sci. USA 82 (1985) 2282-2286] as a probe, is reported. Sequence comparison of the clone EPZP6 with the human alpha 2M cDNA revealed the presence of five exons with the proper splice signals. Alignment of the corresponding amino acid (aa) sequence of these exons with the published partial pregnancy-zone protein (PZP) aa sequence (Sottrup-Jensen et al., Proc. Natl. Acad. Sci. USA 81 (1984) 7353-7357] showed a perfect match, thereby identifying EPZP6 as a PZP genomic clone. The clone MPAM16 showed a considerable degree of sequence conservation when compared to the human alpha 2M cDNA sequence, and several putative exons were identified. However, a frame-shift mutation leading to a premature stop codon was found in the coding sequence, classifying this gene as an alpha 2M pseudogene. Human alpha 2M, PZP and the related pseudogene were mapped to the human chromosome 12p12-13, with the help of gene-specific probes and in situ hybridization. This result was confirmed in Southern-blot experiments with DNA from a human-Ltk- mouse somatic-cell hybrid containing only a human isochromosome 12p in a mouse background.     

cDNA sequence of a Drosophila melanogaster gene, Dfur1, encoding a protein structurally related to the subtilisin-like proprotein processing enzyme furin

Screening a genomic library of Drosophila melanogaster DNA with a human fur cDNA probe resulted in the isolation of DNA clones that apparently belonged to two different DNA regions of the Drosophila genome. Subsequently, corresponding Drosophila cDNA clones were isolated. Nucleotide sequence analysis indicated that these cDNA clones originated from two different genes, which were called Dfur1 and Dfur2. From overlapping Dfur1 cDNA clones, a composite cDNA could be constructed and analysis of its nucleotide sequence revealed the coding sequence for a protein of 899 amino acid residues. This protein, designated Dfurin1, exhibited striking sequence homology to human furin and contained the same protein domains except for the cysteine-rich region. Furthermore, unlike human furin, Dfurin1 possessed an extended amino-terminal region in which a potential transmembrane anchor was present.     

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.     

Molecular cloning and sequence analysis of the (Na+ + K+)-ATPase beta subunit from dog kidney

cDNA complementary to mRNA coding for the beta subunit of dog renal (Na+ + K+)-ATPase has been cloned into lambda gt11 and the nucleotide sequence of the DNA has been determined. The amino acid sequence of the beta subunit polypeptide has also been deduced from the DNA. The mature form of the dog kidney beta subunit contains 302 amino acids with three potential asparagine-linked attachment sites for carbohydrate. The initiation methionine is removed during processing of the polypeptide to its mature form. Although the beta subunit is an integral membrane protein there is no signal sequence for the polypeptide, and hydropathy analysis predicts that the beta subunit polypeptide spans the cell membrane only once. Secondary structure predictions and a model for the structure of the beta subunit are proposed. DNA sequencing of the 5' non-coding region of the mRNA revealed a 200 bp inverted repeat from the coding region. Blot hybridization of a fragment of the beta subunit cDNA identified a single mRNA species of 2.7 kb in dog kidney and several rat tissues. RNA from rat liver was deficient in mRNA that hybridized to the dog kidney beta subunit cDNA, although mRNA that hybridized to an alpha subunit cDNA was detected. RNA from a human hepatoma cell line, HepG2, however, contained comparable levels of mRNA for both the alpha and the beta subunits.     

Immunological identification of rat tissue kallikrein cDNA and characterization of the kallikrein gene family

A tissue kallikrein cDNA was identified by direct immunological screening with affinity-purified anti-rat tissue kallikrein antibody from a rat submandibular cDNA library constructed with the expression vector pUC8. Sequence analysis of the kallikrein cDNA revealed an encoded protein 97% homologous to the partial amino acid sequence of rat submandibular kallikrein. This cDNA was used to hybrid-select kallikrein-specific RNA from submandibular gland. Translation of the hybrid-selected RNA in a cell-free assay system resulted in the production of a 37 kDa peptide representing the preproenzyme. In addition, hybrid-selection of RNA under less stringent conditions showed cross-hybridization with other submandibular gland mRNA species. In correlation with these results, analysis of rat genomic DNA showed extensive hybridization, suggesting a family of closely related kallikrein-like genes. Consequently, a Charon 4A rat genomic library was screened for kallikrein genes by hybridization with rat tissue kallikrein cDNA. Thirty-four clones were isolated and found to be highly homologous by hybridization and restriction enzymes analyses. Fourteen unique clones were identified by restriction enzyme site polymorphisms within DNA segments which hybridized to the kallikrein cDNA probe and it was estimated that at least 17 different kallikrein-like genes are present in the rat. Sequence and structural analysis of one of the genomic clones revealed a gene structure similar to that of other serine proteinases. Comparison of the partially sequenced exon regions of the gene with the sequence of rat tissue kallikrein cDNA reveals 89% identity when aligned for the greatest homology. However, the genomic sequence predicts termination codons in all three translational reading frames, implying that this gene is nonfunctional, i.e., a pseudogene. Comparison of the rat genomic sequence to a kallikrein-like gene from the mouse reveals extensive preservation of exons, less identity within introns and no significant homology between extragenic regions.     

Novel use of a chimpanzee pseudogene for chromosomal mapping of human cytochrome c oxidase subunit IV

We have isolated a chimpanzee processed pseudogene for subunit IV of cytochrome c oxidase (COX; EC 1.9.3.1) by screening a chimpanzee genomic library in lambda Charon 32 with a bovine liver cDNA encoding COX subunit IV (COX IV), and localized it to a 1.9-kb HindIII fragment. Southern-blot analysis of genomic DNA from five primates showed that DNAs from human, gorilla, and chimpanzee each contained the 1.9-kb pseudogene fragment, whereas orangutan and pigtail macaque monkey DNA did not. This result clearly indicates that the pseudogene arose before the divergence of the chimpanzee and gorilla from the primate lineage. By screening Chinese hamster x human hybrid panels with the human COX4 cDNA, we have mapped COX4 genes to two human chromosomes, 14 and 16. The 1.9-kb HindIII fragment containing the pseudogene, COX4P1, can be assigned to chromosome 14, and by means of rearranged chromosomes in somatic cell hybrids, to 14q21-qter. Similarly, the functional gene, COX4, has been mapped to 16q22-qter.     

Chromosomal mapping of the human annexin IV (ANX4) gene.

Annexin IV (placental anticoagulant protein II) is a member of the annexin or lipocortin family of calcium-dependent phospholipid-binding proteins. A cDNA for human annexin IV was isolated from a placental library that is 675 bases longer in the 3' untranslated region than previously reported, indicating the existence of alternative mRNA processing for this gene. Genomic Southern blotting with a cDNA probe indicated a gene size of 18-56 kb. Primers developed for polymerase chain reaction (PCR) allowed amplification of a 1.6-kb portion of the ANX4 gene. DNA sequence analysis showed that this PCR product contained a single intron with exon-intron boundaries in exactly the same position as in the mouse annexin I and annexin II genes. PCR analysis of a somatic cell hybrid panel mapped the ANX4 gene to chromosome 2, and in situ hybridization with a cDNA probe showed a unique locus for ANX4 at 2p13. This study provides further evidence that genes for the annexins are dispersed throughout the genome but are similar in size and exon-intron organization.