Expression of the QrCPE gene is associated with the induction and development of oak somatic embryos

Somatic embryogenesis is a powerful tool for plant regeneration and also provides a suitable material for investigating the molecular events that control the induction and development of somatic embryos. This study focuses on expression analysis of the QrCPE gene (which encodes a glycine-rich protein) during the initiation of oak somatic embryos from leaf explants and also during the histodifferentiation of somatic embryos. Northern blot and in situ hybridization were used to determine the specific localisation of QrCPE mRNA. The results showed that the QrCPE gene is developmentally regulated during the histodifferentiation of somatic embryos and that its expression is tissue- and genotype-dependent. QrCPE was strongly expressed in embryogenic cell aggregates and in embryogenic nodular structures originated in leaf explants as well as in the protodermis of somatic embryos from which new embryos are generated by secondary embryogenesis. This suggests a role for the gene during the induction of somatic embryos and in the maintenance of embryogenic competence. The QrCPE gene was highly expressed in actively dividing cells during embryo development, suggesting that it participates in embryo histodifferentiation. The localised expression in the root cap initial cells of cotyledonary somatic embryos and in the root cap of somatic seedlings also suggests that the gene may be involved in the fate of root cap cells.     

The root form of ferredoxin-NADP oxidoreductase is expressed in rice coleoptiles for the assimilation of nitrate

Two ferredoxin-dependent proteins, nitrite reductase and glutamate synthase, play a role in nitrate assimilation during the anaerobic germination of rice (Oryza sativa L.). This paper reports the expression of the root form of ferredoxin-NADP⁺ oxidoreductase (FNR), the protein responsible for providing reduced ferredoxin in rice coleoptiles. Using an antibody against FNR, a protein with the expected molecular mass for root FNR (35 kDa) was recognized by Western blot analysis in extracts from aerobic and anaerobic coleoptiles. The enzyme is synthesized de novo, as shown by immunoprecipitation of the radiolabeled 35-kDa protein from anaerobic seedlings grown in the presence of [³⁵S]methionine. Northern blot analysis with specific probes for root and leaf FNR showed the presence of mRNA for the root form but not for the leaf form, in both aerobic and anaerobic rice coleoptiles. The inductive effect of exogenous nitrate on the expression of FNR is further evidence for the presence of the root type of FNR in rice coleoptiles. The importance of the expression of root FNR during the anaerobic development of rice seedlings is discussed. Received: 7 October 1996 / Accepted: 22 January 1997     

Leaf Developmental Age Controls Expression of Genes Encoding Enzymes of Chlorophyll and Heme Biosynthesis in Pea (Pisum sativum L.)

The effects of leaf developmental age on the expression of three nuclear gene families in pea (Pisum sativum L.) coding for enzymes of chlorophyll and heme biosynthesis have been examined. The steady-state levels of mRNAs encoding aminolevulinic acid (ALA) dehydratase, porphobilinogen (PBG) deaminase, and NADPH:protochlorophyllide reductase were measured by RNA gel blot and quantitative slot-blot analyses in the foliar leaves of embryos that had imbibed for 12 to 18 h and leaves of developing seedlings grown either in total darkness or under continuous white light for up to 14 d after imbibition. Both ALA dehydratase and PBG deaminase mRNAs were detectable in embryonic leaves, whereas mRNA encoding the NADPH:protochlorophyllide reductase was not observed at this early developmental stage. All three gene products were found to increase to approximately the same extent in the primary leaves of pea seedlings during the first 6 to 8 d after imbibition (postgermination) regardless of whether the plants were grown in darkness or under continuous white-light illumination. In the leaves of dark-grown seedlings, the highest levels of message accumulation were observed at approximately 8 to 10 d postgermination, and, thereafter, a steady decline in mRNA levels was observed. In the leaves of light-grown seedlings, steady-state levels of mRNA encoding the three chlorophyll biosynthetic enzymes were inversely correlated with leaf age, with youngest, rapidly expanding leaves containing the highest message levels. A corresponding increase in the three enzyme protein levels was also found during the early stages of development in the light or darkness; however, maximal accumulation of protein was delayed relative to peak levels of mRNA accumulation. We also found that although protochlorophyllide was detectable in the leaves immediately after imbibition, the time course of accumulation of the phototransformable form of the molecule coincided with NADPH:protochlorophyllide reductase expression. In studies in which dark-grown seedlings of various ages were subsequently transferred to light for 24 and 48 h, the effect of light on changes in steady-state mRNA levels was found to be more pronounced at later developmental stages. These results suggest that the expression of these three genes and likely those genes encoding other chlorophyll biosynthetic pathway enzymes are under the control of a common regulatory mechanism. Furthermore, it appears that not light, but rather as yet unidentified endogenous factors, are the primary regulatory factors controlling gene expression early in leaf development.     

Use of Trichomonas vaginalis clinical isolates to evaluate correlation of gene expression and metronidazole resistance

We investigated whether variations in gene expression of enzymes associated with anaerobic resistance of laboratory-derived strains of Trichomonas vaginalis could be detected in a group of 28 clinical isolates with variations in metronidazole sensitivity. We compared isolates by real-time PCR because this method allows for highly sensitive quantification of mRNA and for evaluation of several genes simultaneously. We found that PFOR gene A mRNA levels were highly correlated with PFOR gene B levels, as well as the D subunit of malic enzyme and ferrodoxin. Ferrodoxin mRNA expression was also significantly correlated with that of malic enzyme and hydrogenase. However, when we evaluated relationships between these enzymes and resistance to metronidazole, we found no significant correlations between aerobic or anaerobic in vitro sensitivity to drug and mRNA levels of any of the enzymes tested. Similarly, using a Student's t-test, no significant differences in enzyme mRNA levels were observed between isolates separated by metronidazole resistance or susceptibility. The lack of correlation between gene expression and resistance or susceptibility could be the result of differences in expression at the protein level or because other biochemical pathways or genes are involved in the resistance observed in clinical settings.     

AtXTH27 plays an essential role in cell wall modification during the development of tracheary elements

Xyloglucan endotransglucosylases/hydrolases (XTHs) are a class of enzymes capable of catalyzing the molecular grafting between xyloglucans and/or the endotype hydrolysis of a xyloglucan molecule. They are encoded by 33 genes in Arabidopsis. Whereas recent studies have revealed temporally and spatially specific expression profiles for individual members of this family in plants, their biological roles are still to be clarified. To identify the role of each member of this gene family, we examined phenotypes of mutants in which each of the Arabidopsis XTH genes was disrupted. This was undertaken using a reverse genetic approach, and disclosed two loss-of-function mutants for the AtXTH27 gene, xth27-1 and xth27-2. These exhibited short-shaped tracheary elements in tertiary veins, and reduced the number of tertiary veins in the first leaf. In mature rosette leaves of the mutant, yellow lesion-mimic spots were also observed. Upon genetic complementation by introducing the wild-type XTH27 gene into xth27-1 mutant plants, the number of tertiary veins was restored, and the lesions disappeared completely. Extensive expression of the pXTH27::GUS fusion gene was observed in immature tracheary elements in the rosette leaves. The highest level of AtXTH27 mRNA expression in the rosette leaves was observed during leaf expansion, when the tracheary elements were elongating. These findings indicate that AtXTH27 plays an essential role during the generation of tracheary elements in the rosette leaves of Arabidopsis.     

Soybean Seed Protein Genes Are Regulated Spatially during Embryogenesis

We used in situ hybridization to investigate Kunitz trypsin inhibitor gene expression programs at the cell level in soybean embryos and in transformed tobacco seeds. The major Kunitz trypsin inhibitor mRNA, designated as KTi3, is first detectable in a specific globular stage embryo region, and then becomes localized within the axis of heart, cotyledon, and maturation stage embryos. By contrast, a related Kunitz trypsin inhibitor mRNA class, designated as KTi1/2, is not detectable during early embryogenesis. Nor is the KTi1/2 mRNA detectable in the axis at later developmental stages. Outer perimeter cells of each cotyledon accumulate both KTi1/2 and KTi3 mRNAs early in maturation. These mRNAs accumulate progressively from the outside to inside of each cotyledon in a "wave-like" pattern as embryogenesis proceeds. A similar KTi3 mRNA localization pattern is observed in soybean somatic embryos and in transformed tobacco seeds. An unrelated mRNA, encoding [beta]-conglycinin storage protein, also accumulates in a wave-like pattern during soybean embryogenesis. Our results indicate that cell-specific differences in seed protein gene expression programs are established early in development, and that seed protein mRNAs accumulate in a precise cellular pattern during seed maturation. We also show that seed protein gene expression patterns are conserved at the cell level in embryos of distantly related plants, and that these patterns are established in the absence of non-embryonic tissues.     

Tissue-specific expression of a gene encoding a cell wall-localized lipid transfer protein from Arabidopsis.

Nonspecific lipid transfer proteins (LTPs) from plants are characterized by their ability to stimulate phospholipid transfer between membranes in vitro. However, because these proteins are generally located outside of the plasma membrane, it is unlikely that they have a similar role in vivo. As a step toward identifying the function of these proteins, one of several LTP genes from Arabidoposis has been cloned and the expression pattern of the gene has been examined by analysis of the tissue specificity of beta-glucuronidase (GUS) activity in transgenic plants containing LTP promoter-GUS fusions and by in situ mRNA localization. The LTP1 promoter was active early in development in protoderm cells of embryos, vascular tissues, lignified tips of cotyledons, shoot meristem, and stipules. In adult plants, the gene was expressed in epidermal cells of young leaves and the stem. In flowers, expression was observed in the epidermis of all developing influorescence and flower organ primordia, the epidermis of the siliques and the outer ovule wall, the stigma, petal tips, and floral nectaries of mature flowers, and the petal/sepal abscission zone of mature siliques. The presence of GUS activity in guard cells, lateral roots, pollen grains, leaf vascular tissue, and internal cells of stipules and nectaries was not confirmed by in situ hybridizations, supporting previous observations that suggest that the reporter gene is subject to artifactual expression. These results are consistent with a role for the LTP1 gene product in some aspect of secretion or deposition of lipophilic substances in the cell walls of expanding epidermal cells and certain secretory tissues. The LTP1 promoter region contained sequences homologous to putative regulatory elements of genes in the phenylpropanoid biosynthetic pathway, suggesting that the expression of the LTP1 gene may be regulated by the same or similar mechanisms as genes in the phenylpropanoid pathway.     

Dynamic expression of manganese superoxide dismutase during mouse embryonic organogenesis

The balance between reactive oxygen species production and antioxidant defense enzymes in embryos is necessary for normal embryogenesis. To determine the dynamic expression profile of manganese superoxide dismutase (MnSOD) in embryos, which is an essential antioxidant enzyme in embryonic organogenesis, the expression level and distribution of MnSOD mRNA and protein were investigated in mouse embryos, as well as extraembryonic tissues on embryonic days (EDs) 7.5-18.5. MnSOD mRNA levels were remarkably high in extraembryonic tissues rather than in embryos during these periods. MnSOD protein levels were also higher in extraembryonic tissues than in embryos until ED 16.5, but the opposite trend was found after ED 17.5. MnSOD mRNA was observed in the chorion, allantois, amnion, ectoderm, ectoplacental cone and neural fold at ED 7.5 and in the neural fold, gut, ectoplacental cone, outer extraembryonic membranes and primitive heart at ED 8.5. After removing the extraembryonic tissues, the prominent expression of MnSOD mRNA in embryos was seen in the sensory organs, central nervous system and limbs on EDs 9.5-12.5 and in the ganglia, spinal cord, sensory organ epithelia, lung, blood cells and vessels, intestinal and skin epithelia, hepatocytes and thymus on EDs 13.5-18.5. Strong MnSOD immunoreactivity was observed in the choroid plexus, ganglia, myocardium, blood vessels, heapatocytes, pancreatic acinus, osteogenic tissues, brown adipose tissue, thymus and skin. These findings suggest that MnSOD is mainly produced from extraembryonic tissues and then may be utilized to protect the embryos against endogenous or exogenous oxidative stress during embryogenesis.     

Identification of a 20-bp regulatory element of the <Emphasis Type="Italic">Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase α2</Emphasis> gene that is essential for expression

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPalpha genes were analyzed using transgenic plants containing a promoter::ss-glucuronidase (GUS) fusion construct. Whereas the AtPFPalpha1 promoter was found to be ubiquitously active in all tissues, the AtPFPalpha2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPalpha2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPalpha2 and which is essential for AtPFPalpha2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFPalpha2 is sufficient for normal AtPFPalpha2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPalpha2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.