Binding of netropsin to a DNA triple helix.

The interaction of netropsin, a minor groove binding drug, with T-A-T triple helix and A-T double helix was studied using circular dichroism spectroscopy and thermal denaturation. The triple helix was made by an oligonucleotide (dA)12-x-(dT)12-x-(dT)12, where x is a hexaethylene glycol chain bridged between the 3' phosphate of one strand and the 5' phosphate of the following strand. This oligonucleotide is able to fold back on itself to form a very stable triplex. Changing the conditions allows the same oligonucleotide in a duplex form with a (dT)12 dangling arm. Circular dichroism spectroscopy demonstrates that netropsin can bind to the triple helical structure. Spectral analysis shows that the bound drug exhibits a conformation and an environment similar in double-stranded and in triple-stranded structure. However, the binding constant to the triple-stranded structure is found smaller than the binding constant to the double-stranded one. Thermal denaturation experiments demonstrate that netropsin destabilizes the triplex whereas it stabilizes the duplex.     

Binding of bis-linked netropsin derivatives in the parallel-stranded hairpin form to DNA

Cis-diammine Pt(II)- bridged bis-netropsin and oligomethylene-bridged bis-netropsin in which two monomers are linked in a tail-to-tail manner bind to the DNA oligomer with the sequence 5'-CCTATATCC-3' in a parallel-stranded hairpin form with a stoichiometry 1:1. The difference circular dichroism (CD) spectra characteristic of binding of these ligands in the hairpin form are similar. They differ from CD patterns obtained for binding to the same duplex of another bis-netropsin in which two netropsin moieties were linked in a head-to-tail manner. This reflects the fact that tail-to-tail and head-to-tail bis-netropsins use parallel and antiparallel side-by-side motifs, respectively, for binding to DNA in the hairpin forms. The binding affinity of cis-diammine Pt(II)-bridged bis-netropsin in the hairpin form to DNA oligomers with nucleotide sequences 5'-CCTATATCC-3' (I), 5'-CCTTAATCC-3' (II), 5'-CCTTATTCC-3' (III), 5'-CCTTTTTCC-3' (IV) and 5'-CCAATTTCC-3' (V) decreases in the order I = II > III > IV > V . The binding of oligomethylene-bridged bis-netropsin in the hairpin form follows a similar hierarchy. An opposite order of sequence preferences is observed for partially bonded monodentate binding mode of the synthetic ligand.     

Binding of netropsin to DNA in complexes with polypeptides containing repetitive lysine sequences

The interaction of the antibiotic netropsin with calf thymus DNA, T4 DNA and poly(dA-dT) . poly(dA-dT) in complexes with sequential polypeptides containing repetitive lysine sequences and histone H1 was investigated using circular dichroism spectroscopy and equilibrium dialysis. Both soluble DNA-polypeptide complexes and insoluble complexes showed binding of netropsin. The possibility of displacement of polypeptides from DNA binding sites by competition with netropsin molecules was eliminated by experiments using 14C-labelled polypeptides. From the analysis of CD titration behavior as well as from the results of equilibrium dialysis studies it follows that netropsin does not compete with polypeptides for DNA binding sites, which suggests that these two ligands occupy different sites. Various explanations for minor differences in the CD behavior of the bound netropsin in the saturation region are also discussed.     

Binding properties and DNA sequence-specific recognition of two bithiazole-linked netropsin hybrid molecules.

We report the DNA binding properties of two hybrid molecules which result from the combination of the DNA sequence-specific minor groove ligand netropsin with the bithiazole moiety of the antitumor drug bleomycin. The drug-DNA interaction has been investigated by means of electric linear dichroism (ELD) spectroscopy and DNase I footprinting. In compound 1 the two moieties are linked by a flexible aliphatic tether while in compound 2 the two aromatic ring systems are directly coupled by a rigid peptide bond. The results are consistent with a model in which the netropsin moiety of compound 1 resides in the minor groove of DNA and where the appended bithiazole moiety is projected away from the DNA groove. This monocationic hybrid compound has a weak affinity for DNA and shows a strict preference for A and T stretches. ELD measurements indicate that in the presence of DNA compound 2 has an orientation typical of a minor groove binder. Similar orientation angles were measured for netropsin and compound 2. This ligand which has a biscationic nature tightly binds to DNA (Ka = 6.3 x 10(5) M-1) and is mainly an AT-specific groove binder. But, depending on the nature of the sequence flanking the AT site first targeted by its netropsin moiety, the bithiazole moiety of 2 can accommodate various types of nucleotide motifs with the exception of homooligomeric sequences. As evidenced by footprinting data, the bithiazole group of bleomycin acts as a DNA recognition element, offering opportunities to recognize GC bp-containing DNA sequences with apparently a preference (although not absolute) for a pyrimidine-G-pyrimidine motif. Thus, the bithiazole unit of bleomycin provides an additional anchor for DNA binding and is also capable of specifically recognizing particular DNA sequences when it is appended to a strongly sequence selective groove binding entity. Finally, a model which schematizes the binding of compound 2 to the sequence 5'-TATGC is proposed. This model readily explains the experimentally observed specificity of this netropsin-bithiazole conjugate.     

Interaction of the peptide antibiotic bacitracin with DNA and synthetic polynucleotides

The aim of the present paper was to study the specific character of interaction of peptide antibiotic bacitracin with DNA and to estimate the interaction constant. The influence of bacitracin on bacteriophage DNA restriction by HindIII and SmaI endonucleases was studied. The possibility of arranging the polynucleotide template by small ligands was shown.     

Conformation dependent binding of netropsin and distamycin to DNA and DNA model polymers

The binding of the antibiotics netropsin and distamycin A to DNA has been studied by thermal melting, CD and sedimentation analysis. Netropsin binds strongly at antibiotic/nucleotide ratios up to at least 0.05. CD spectra obtained using DNA model polymers reveal that netropsin binds tightly to poly (dA) · poly (dT), poly (dA-dT) · poly(dA-dT) and poly (dI-dC) · poly (dI-dC) but poorly, if at all, to poly (dG) · poly (dC). Binding curves obtained with calf thymus DNA reveal one netropsin-binding site per 6.0 nucleotides (K_a=2.9 · 10⁵ M⁻¹); corresponding values for distamycin A are one site per 6.1 nucleotides with K_a= 11.6 · 10⁵ M⁻¹. Binding sites apparently involve predominantly A·T-rich sequences whose specific conformation determines their high affinity for the two antibiotics. It is suggested that the binding is stabilized primarily by hydrogen bonding and electrostatic interactions probably in the narrow groove of the DNA helix, but without intercalation. Any local structural deformation of the helix does not involve unwinding greater than approximately 3° per bound antibiotic molecule.     

Base specificity of polyamine binding to synthetic polynucleotides.

The binding of polyamines and magnesium to synthetic polynucleotides has been studied by gel filtration on a Sephadex G-50 column. Among the single-stranded polynucleotides examined [poly(A), poly(C), and poly(U)], polyamines were found to bind to poly(C) and poly(U) preferentially, while the binding of Mg2+ was greatest with poly(A). Spermine bound to poly(U) was displaced completely by NH4+ but incompletely by Mg2+, while Mg2+ bound to poly(A) was displaced completely be spermine but incompletely by NH4+. The optimal pH for the binding of spermine to poly(U) was found to be about 7.9, while Mg2+ could bind to poly(A) over a broad pH range (7.1--8.7).     

The osmotic sensitivity of netropsin analogue binding to DNA

The binding of a netropsin analogue to random sequence DNA, monitored by CD, is seen dependent on the concentration of neutral solutes. The binding free energy decreases linearly with solute osmolal concentration and the magnitude of the effect is insensitive to the chemical identity of the solute fur betaine, sorbitol, and triethylene glycol. These solutes appear to modulate binding through their effect on water activity and changes in the hydration of the drug and DNA in the complex reaction, not through a direct interaction with the reactants or the product. The dependence of binding constant on solute concentration can be interpreted as an additional binding of some 50–60 extra solute excluding water molecules by the complex. A water sensitivity of drug binding is further seen from the dependence of binding constants on the type of anion in solution. Anions in the Hofmeister series strongly affect bulk water free energies and entropies. The differences in netropsin analogue binding to DNA with Cl⁻, F⁻, and CIO are consistent with the effect observed with neutral solutes. The ability to measure changes in water binding associated with a specific DNA interaction is a first step toward correlating changes in hydration with the strength and specificity of binding. © 1995 John Wiley & Sons, Inc.     

Binding of ligands to a one-dimensional heterogeneous lattice. II. Intercalation of tilorone with DNA and polynucleotides

The interaction of tilorone with DNA and five synthetic polydeoxyribonucleotides [(I): poly[d(A-T)]·poly[d(A-T)]; (II): poly[d(A-C)]·poly[d(G-T)]; (III): poly[d(G-C)]·poly[d(G-C)]; (IV): poly(dG)·poly(dC); and (V): poly(dA)·poly(dT)] has been investigated. Binding isotherms for the homopolymers were obtained by microdialysis equilibria using ¹⁴C-labeled tilorone and interpreted with different models: exclusion effect, associated or not associated with cooperativity, or variable exclusion. Affinity appears to be related more to local structure than to base composition and decreases in the following order: (I) > (II) > (III) > (IV) > (V). Intercalation in circular DNA was demonstrated by electrophoresis migration and electron microscopy, which yielded an average unwinding angle of 7° per bound dye. The behavior observed in CD and UV spectroscopy shows a sequence similar to the affinities. Tilorone seems to be less intercalated in (IV) and not at all in (V). The experimental binding isotherm of tilorone to DNA was well fitted on the basis of a model where DNA acts as a heterogeneous lattice built with the six different possible couples of adjacent base pairs, each potential site behaving as if it were in the corresponding homopolymer. The results are discussed in terms of specificity of alternating Pyr-Pur sequences and related to theoretical calculations on intercalation energies of DNA.     

Photodynamic activity of acridine orange: peroxide radical induction in DNA and synthetic polynucleotides

As shown by electron paramagnetic resonance, acridine orange induces the formation of peroxide radicals in DNA when dye-DNA mixtures frozen at 77 K are irradiated with visible light. The reaction is oxygen dependent and strongly reduced by the addition of an electron scavenger. Factors of the medium can modulate the reaction: an ionic strength increased up to 0.3 greatly enhances the dye efficiency whereas the presence of phosphate ions has an inhibiting influence. Acridine orange, which is slightly less efficient than proflavine on native DNA, induces an important peroxide radical formation in poly(dG).poly(dC) but has no action on the poly(dA).poly(dT)polymer.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Interference of tolerance to human gamma globulin by synthetic polynucleotides.

A complex of polyadenylic-polyuridylic acids effectively inhibits the in vivo production of immunologic tolerance to human gamma globulin in mice. Moreover, this effect can be obtained only when the polynucleotide complex is given within 4 hr after antigen administration.Reconstitution of irradiated mice with combinations of T and B cells originating from tolerant or previously untreated mice demonstrates that poly A:U is responsible for the adjuvant effect observed. Poly A:U exerts its adjuvant effect primarily upon T cells, while B cells remain essentially uninfluenced by the polynucleotides.     

Interaction of ellipticine and an indolo[2,3b]-quinoxaline derivative with DNA and synthetic polynucleotides

The non-covalent DNA interaction of the anticancer drug ellipticine (Scheme I, 1a) as well as an indolo[2,3-b]-quinoxaline derivative (Scheme I, 3b) with a dimethylaminoethyl side chain has been studied by light absorption, linear dichroism (LD) and fluorescence. Compound 3b (Scheme I) has antitumorigenic as well as antiviral activity. Both compounds bind to DNA or synthetic polynucleotides such as poly(dA-dT).(dA-dT) and poly(dG-dC).(dG-dC) by intercalation. In contrast to ellipticine, compound 3b (Scheme I) exhibits a significant binding specificity for alternating AT sequences. Its fluorescence is strongly enhanced in AT sequences and quenched in GC sequences. Fluorescence titrations evaluated as Scatchard plots show that both ellipticine and compound 3b (Scheme I) bind to the nucleic acids according to a non-cooperative neighbor exclusion model.