Thermal denaturation of wild type and mutant recombinant acetylcholinesterase from amphioxus: effects of the temperature of in vitro expression and of reversible inhibitors

We have studied the thermal inactivation at 37 degrees C of wild type and mutant ChE2 (C310A, F312I, C466A, C310A/F312I, and C310A/C466A) from amphioxus (Branchiostoma floridae) expressed in vitro in COS-7 monkey cells under three sets of conditions: 30 degrees C for 48 h, 30 degrees C for 24 h and 37 degrees C for 24 h, and 37 degrees C for 48 h. We found biphasic denaturation curves for all enzymes and conditions, except wild type and C310A ChE2 expressed at 30 degrees C for 48 h. Generally, single mutants are more unstable than wild type, and the double mutants are even more unstable. We propose a model involving stable and unstable conformations of the enzymes to explain these results, and we discuss the implications of the model. We also found a correlation between the melting temperature of the ChEs and the rates at which they denature at 37 degrees C, with the denaturation of the unstable conformation dominating the relationship. Reversible cholinergic inhibitors protect the ChEs from thermal denaturation, and in some cases produce monophasic denaturation curves; we also propose a model to explain this stabilization.     

Real-time oligonucleotide hybridization kinetics monitored by resonant mirror technique

The kinetics of hybridization of 11-meric and 14-meric oligonucleotides, dTGGGAAGAGGG (ODN-11) and dTGGGAAGAGG GTCA (ODN-14), with 14-meric oligonucleotide dpTGACCCTCT TCCCA (p14) attached to the surface of a cuvette was studied by the resonant mirror method. The treatment of the experimental curves with exponential equations leads to the following values for association (kas) and dissociation (kdis) rate constants at 25 degrees C: kas = 219 +/- 39 and 183 +/- 162 M-1 s-1, kdis = (2.0 +/- 0.4) x 10(-3) and (4 +/- 1) x 10(-4) s-1 for the duplexes (p14) x (ODN-11) and p14 x (ODN-14), respectively. The oligonucleotide dTGCCTTGAATGGGAA GAGGGTCA (ODN-23), which forms a hairpin structure, does not associate with p14. The data were compared with the results of melting curve detection and temperature-jump experiments. The association rate constants for ODN-11 and ODN-14 are much slower than those values in homogeneous aqueous solution. The dissociation rate constants have the same magnitude values as estimated by using association constants measured from melting curves but differ from the values estimated in temperature-jump experiments.     

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.     

Antisense properties of tricyclo-DNA

Tricyclo (tc)-DNA belongs to the class of conformationally constrained DNA analogs that show enhanced binding properties to DNA and RNA. We prepared tc-oligonucleotides up to 17 nt in length, and evaluated their binding efficiency and selectivity towards complementary RNA, their biological stability in serum, their RNase H inducing potential and their antisense activity in a cellular assay. Relative to RNA or 2'-O-Me-phosphorothioate (PS)-RNA, fully modified tc-oligodeoxynucleotides, 10-17 nt in length, show enhanced selectivity and enhanced thermal stability by approximately 1 degrees C/modification in binding to RNA targets. Tricyclodeoxyoligonucleotides are completely stable in heat-deactivated fetal calf serum at 37 degree C. Moreover, tc-DNA-RNA duplexes are not substrates for RNase H. To test for antisense effects in vivo, we used HeLa cell lines stably expressing the human beta-globin gene with two different point mutations in the second intron. These mutations lead to the inclusion of an aberrant exon in beta-globin mRNA. Lipofectamine-mediated delivery of a 17mer tc-oligodeoxynucleotide complementary to the 3'-cryptic splice site results in correction of aberrant splicing already at nanomolar concentrations with up to 100-fold enhanced efficiency relative to a 2'-O-Me-PS-RNA oligonucleotide of the same length and sequence. In contrast to 2'-O-Me-PS-RNA, tc-DNA shows antisense activity even in the absence of lipofectamine, albeit only at much higher oligonucleotide concentrations.     

Sequence-specific conjugates of oligo(2'-O-methylribonucleotides) and hairpin oligocarboxamide minor-groove binders: design, synthesis, and binding studies with double-stranded DNA

New conjugates of triplex-forming pyrimidine oligo(2'-O-methylribonucleotides) with one or two 'head-to-head' hairpin oligo(N-methylpyrrole carboxamide) minor-groove binders (MGBs) attached to the terminal phosphate of the oligonucleotides with a oligo(ethylene glycol) linker were synthesized. It was demonstrated that, under appropriate conditions, the conjugates form stable complexes with double-stranded DNA (dsDNA) similarly to triplex-forming oligo(deoxyribonucleotide) (TFO) conjugates containing 5-methylated cytosines. Kinetic and thermodynamic parameters of the complex formation were evaluated by gel-shift assay and thermal denaturation. Higher melting temperatures (Tm), faster complex formation, and lower dissociation constants (Kd) of the triple helices (6-7 nM) were observed for complexes of MGB-oligo(2'-O-methylribonucleotide) conjugates with the target dsDNA compared to the nonconjugated individual components. Interaction of MGB moieties with the HIV proviral DNA fragment was indicated by UV/VIS absorption changes at 320 nm in the melting curves. The introduction of thymidine via a 3',3'-type 'inverted' phosphodiester linkage at the 3'-end of oligo(2'-O-methylribonucleotide) conjugates (3'-protection) had no strong influence on triplex formation, but slightly affected complex stability. At pH 6.0, when one or two hairpin MGBs were attached to the oligonucleotide, both triplex formation and minor-groove binding played important roles in complex formation. When two 'head-to-head' oligo(N-methylpyrrole) ligands were attached to the same terminal phosphate of the oligonucleotide or the linker, binding was observed at pH >7.5 and at high temperatures (up to 74 degrees). However, under these conditions, binding was retained only by the MGB part of the conjugate.     

Thermodynamics of RNA duplexes with tandem mismatches containing a uracil-uracil pair flanked by C.G/G.C or G.C/A.U closing base pairs

The thermodynamics governing the denaturation of RNA duplexes containing 8 bp and a central tandem mismatch or 10 bp were evaluated using UV absorbance melting curves. Each of the eight tandem mismatches that were examined had one U-U pair adjacent to another noncanonical base pair. They were examined in two different RNA duplex environments, one with the tandem mismatch closed by G.C base pairs and the other with G.C and A.U closing base pairs. The free energy increments (Delta Gdegrees(loop)) of the 2 x 2 loops were positive, and showed relatively small differences between the two closing base pair environments. Assuming temperature-independent enthalpy changes for the transitions, (Delta Gdegrees(loop)) for the 2 x 2 loops varied from 0.9 to 1.9 kcal/mol in 1 M Na(+) at 37 degrees C. Most values were within 0.8 kcal/mol of previously estimated values; however, a few sequences differed by 1.2-2.0 kcal/mol. Single strands employed to form the RNA duplexes exhibited small noncooperative absorbance increases with temperature or transitions indicative of partial self-complementary duplexes. One strand formed a partial self-complementary duplex that was more stable than the tandem mismatch duplexes it formed. Transitions of the RNA duplexes were analyzed using equations that included the coupled equilibrium of self-complementary duplex and non-self-complementary duplex denaturation. The average heat capacity change (DeltaC(p)) associated with the transitions of two RNA duplexes was estimated by plotting DeltaH degrees and DeltaS degrees evaluated at different strand concentrations as a function of T(m) and ln T(m), respectively. The average DeltaC(p) was 70 +/- 5 cal K(-)(1) (mol of base pairs)(-)(1). Consideration of this heat capacity change reduced the free energy of formation at 37 degrees C of the 10 bp control RNA duplexes by 0.3-0.6 kcal/mol, which may increase Delta Gdegrees(loop) values by similar amounts.     

Optimization of an oligonucleotide microchip for microbial identification studies: a non-equilibrium dissociation approach

The utility of a high-density oligonucleotide microarray (microchip) for identifying strains of five closely related bacilli ( Bacillus anthracis , Bacillus cereus , Bacillus mycoides , Bacillus medusa and Bacillus subtilis ) was demonstrated using an approach that compares the non-equilibrium dissociation rates ('melting curves') of all probe–target duplexes simultaneously. For this study, a hierarchical set of 30 oligonucleotide probes targeting the 16S ribosomal RNA of these bacilli at multiple levels of specificity (approximate taxonomic ranks of domain, kingdom, order, genus and species) was designed and immobilized in a high-density matrix of gel pads on a glass slide. Reproducible melting curves for probes with different levels of specificity were obtained using an optimized salt concentration. Clear discrimination between perfect match (PM) and mismatch (MM) duplexes was achieved. By normalizing the signals to an internal standard (a universal probe), a more than twofold discrimination (> 2.4×) was achieved between PM and 1-MM duplexes at the dissociation temperature at which 50% of the probe–target duplexes remained intact. This provided excellent differentiation among representatives of different Bacillus species, both individually and in mixtures of two or three. The overall pattern of hybridization derived from this hierarchical probe set also provided a clear 'chip fingerprint' for each of these closely related Bacillus species.     

Manipulating the salt and thermal stability of DNA multilayer films via oligonucleotide length

DNA films are promising materials for diverse applications, including sensing, diagnostics, and drug/gene delivery. However, the ability to tune the stability of DNA films remains a crucial aspect for such applications. Herein, we examine the role of oligonucleotide length on the formation, and salt and thermal stability, of DNA multilayer films using oligonucleotides of homopolymeric diblocks (polyAG and polyTC), with each block (A, G, T, or C) ranging from 5 to 30 bases (10-, 20-, 30-, 40-, and 60-mer). Using a combination of quartz crystal microgravimetry, dual polarization interferometry, and flow cytometry, we demonstrate that at least 10 bases per hybridizing block in the DNA diblocks (that is, 20-mer) are required for successful hybridization and, hence, DNA multilayer film formation. Films assembled using longer oligonucleotide blocks were more stable in low salt conditions, with the DNA multilayer films assembled from the 60-mer oligonucleotides remaining intact in solutions of about 25 mM NaCl. A systematic increase in film melting temperature ( T m) was observed for the DNA multilayer films (assembled on colloids) with increasing oligonucleotide length, ranging from 38.5 degrees C for the 20-mer films to 53 degrees C for the 60-mer films. Further, an alternating trend in T m of the DNA multilayer films was observed with layer number (AG or TC); DNA multilayer films terminated with an AG layer exhibited a higher T m (44-49 degrees C) than films with an outermost TC layer (ca. 38 degrees C), suggesting a rearrangement of the film structure upon hybridization of the outermost layer. This work shows that the stability of DNA multilayer films can be tuned by varying the length of the oligonucleotide building blocks, thus providing a versatile means to tailor the salt and thermal stability of DNA films, which is necessary for the application of such films.     

RNA-DNA hybridization promoted by E. coli RecA protein.

RecA protein of E. coli plays a central regulatory role that is induced by damage to DNA and results in the inactivation of LexA repressor. In vitro, RecA protein binds preferentially to single-stranded DNA to form a nucleoprotein filament that can recognize homology in naked duplex DNA and promote extensive strand exchange. Although RecA protein shows little tendency at neutral pH to bind to RNA, we found that it nonetheless catalyzed at 37 degrees C the hybridization of complementary RNA and single-stranded DNA sequences. Hybrids made by RecA protein at 37 degrees C appeared indistinguishable from ones prepared by thermal annealing. RNA-DNA hybridization by RecA protein at neutral pH required, as does RecA-promoted homologous pairing, optimal conditions for the formation of RecA nucleoprotein filaments. The cosedimentation of RNA with those filaments further paralleled observations made on the formation of networks of nucleoprotein filaments with double-stranded DNA, an instrumental intermediate in homologous pairing in vitro. These similarities with the pairing reaction support the view that RecA protein acts specifically in the hybridization reaction.     

Thermodynamic dependence of DNA/DNA and DNA/RNA hybridization reactions on temperature and ionic strength

The thermodynamics of 5'-ATGCTGATGC-3' binding to its complementary DNA and RNA strands was determined in sodium phosphate buffer under varying conditions of temperature and salt concentration from isothermal titration calorimetry (ITC). The Gibbs free energy change, DeltaG degrees of the DNA hybridization reactions increased by about 6 kJ mol(-1) from 20 degrees C to 37 degrees C and exhibited heat capacity changes of -1.42 +/- 0.09 kJ mol(-1) K(-1) for DNA/DNA and -0.87 +/- 0.05 kJ mol(-1) K(-1) for DNA/RNA. Values of DeltaG degrees decreased non-linearly by 3.5 kJ mol(-1) at 25 degrees C and 6.0 kJ mol(-1) at 37 degrees C with increase in the log of the sodium chloride concentration from 0.10 M to 1.0 M. A near-linear relationship was observed, however, between DeltaG degrees and the activity coefficient of the water component of the salt solutions. The thermodynamic parameters of the hybridization reaction along with the heat capacity changes were combined with thermodynamic contributions from the stacking to unstacking transitions of the single-stranded oligonucleotides from differential scanning calorimetry (DSC) measurements, resulting in good agreement with extrapolation of the free energy changes to 37 degrees C from the melting transition at 56 degrees C.     

Temperature dependence of the rate constants of the Escherichia coli RNA polymerase-lambda PR promoter interaction. Assignment of the kinetic steps corresponding to protein conformational change and DNA opening

The kinetics of formation and of dissociation of open complexes (RPo) between Escherichia coli RNA polymerase (R) and the lambda PR promoter (P) have been studied as a function of temperature in the physiological range using the nitrocellulose filter binding assay. The kinetic data provide further evidence for the mechanism R + P in equilibrium I1 in equilibrium I2 in equilibrium RPo, where I1 and I2 are kinetically distinguishable intermediate complexes at this promoter which do not accumulate under the reaction conditions investigated. The overall second-order association rate constant (ka) increases dramatically with increasing temperature, yielding a temperature-dependent activation energy in the range 20 kcal (near 37 degrees C) to 40 kcal (near 13 degrees C) (1 kcal = 4.184 kJ). Both isomerization steps (I1----I2 and I2----RPo) appear to be highly temperature dependent. Except at low temperatures (less than 13 degrees C) the step I1----I2, which we attribute to a conformational change in the polymerase with a large negative delta Cp degrees value, is rate-limiting at the reactant concentrations investigated and hence makes the dominant contribution to the apparent activation energy of the pseudo first-order association reaction. The subsequent step I2----RPo, which we attribute to DNA melting, has a higher activation energy (in excess of 100 kcal) but only becomes rate-limiting at low temperature (less than 13 degrees C). The initial binding step R + P in equilibrium I1 appears to be in equilibrium on the time-scale of the isomerization reactions under all conditions investigated; the equilibrium constant for this step is not a strong function of temperature and is approximately 10(7) M-1 under the standard ionic conditions of the assay (40 mM-Tris . HCl (pH 8.0), 10 mM-MgCl2, 0.12 M-KC1). The activation energy of the dissociation reaction becomes increasingly negative at low temperatures, ranging from approximately -9 kcal near 37 degrees C to -30 kcal near 13 degrees C. Thermodynamic (van't Hoff) enthalpies delta H degrees of open complex formation consequently are large and temperature-dependent, increasing from approximately 29 to 70 kcal as the temperature is reduced from 37 to 13 degrees C. The corresponding delta Cp degrees value is approximately -2.4 kcal/deg. We propose that this large negative delta Cp degrees value arises primarily from the burial of hydrophobic surface in the conformational change (I1 in equilibrium I2) in RNA polymerase in the key second step of the mechanism.(ABSTRACT TRUNCATED AT 400 WORDS)     

Detection of polymorphisms at exons 3 (Tyr113-->His) and 4 (His139-->Arg) of the microsomal epoxide hydrolase gene using fluorescence PCR method combined with melting curves analysis

An association between exon 3 polymorphisms of the gene encoding microsomal epoxide hydrolase (mEH) and susceptibility to the development of chronic obstructive pulmonary disease (COPD) has been described. We have developed two methods for detecting polymorphisms at exons 3 (Tyr113-->His) and 4 (His139-->Arg) of the mEH gene based on different melting temperatures (T(m)) of fluorescent-labeled oligonucleotide hybridization probes using single-step assays that combine fluorescence PCR and melting curve analysis (LightCycler methodology). DNA was extracted from blood in 79 COPD patients and 146 healthy controls. Results were compared with those obtained by restriction fragment length polymorphism (RFLP) analysis to detect Tyr113His variants and a single-strand conformation polymorphism (SSCP) assay for His139Arg detection. The T(m) of the exon 3 polymorphisms were 61.3 degrees C for Tyr113 (wild type) and 67.5 degrees C for His113 (mutant). The T(m) values of the exon 4 polymorphisms were 67.5 degrees C for His139 (wild type) and 59.2 degrees C for Arg139 (mutant). The within- and between-run melting peaks for the same allele differed by less than 0.5 degrees C for both the exon 3 and the exon 4 polymorphisms. Thus, melting analysis allowed easy and unambiguous assignment of genotyping by means of the respective melting curves. The proportion of individuals who were homozygous mutant for exon 3 was significantly higher in the COPD group than in the control group (p=0.004). LightCycler fluorescence genotyping of exon 4 polymorphisms correlated perfectly with SSCP results. RFLP assay classified 2 patients as homozygous mutant while LightCycler analysis genotyped them as heterozygous. DNA analysis by PCR and sequencing confirmed the LightCycler result. These high-speed (about 40 min for 32 samples), highly sensitive, and specific small-volume assays with low labor requirements hold great promise as tools for rapid detection of COPD susceptibility.     

Characterization of central cholecystokinin receptors using a radioiodinated octapeptide probe

We have developed a binding assay for 125I-Bolton-Hunter-labeled cholecystokinin octapeptide (125I-(BH)CCK8) using mouse cerebral cortex membrane preparations. This ligand interacts with cortical membrane preparations in a saturable, high-affinity manner, satisfying the requirements for specific cholecystokinin receptor labeling. Salt is required for maximal binding and BSA is specifically inhibitory with cerebral cortical but not with pancreatic sites. Cholecystokinin peptides as small as CCK30-33 displace binding at low nanomolar concentrations. Dissociation of 125I-(BH)CCK8 is biphasic in both mouse and guinea pig cortex. Pretreatment of membranes at 37 degrees C results in a marked loss of recognition sites, suggesting that the sites may be rapidly metabolized in vivo. After 37 degrees C pretreatment, the loss of CCK recognition sites corresponds to a selective loss of the slow component of dissociation curves. This selective elimination of one dissociation population, as well as the biphasic dissociation kinetics, suggests that at least two distinct CCK receptor subtypes exist in the brain.     

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.     

Thermodynamic description of oligonucleotide self-association in DNA concatamer structures

A scheme of equilibrium formation of concatamers by two different oligonucleotides has been considered. It is shown that in the general case, the dependence of the concentration of oligonucleotide components on temperature cannot be found in analytical form. Therefore, it is impossible to find the thermodynamic parameters of concatamer formation (ΔH ⁰, ΔS ⁰) and melting temperatures by analyzing the profiles of thermal denaturation of oligonucleotide complexes. An algorithm for numerical solution of implicit dependences has been developed. A number of approaches are considered that simplify the analysis of heat denaturation curves for concatamer complexes. It is shown that the dependence of the efficiency of concatamerization on temperature can be described analytically when duplex fragments have close stability and there is no cooperativity at the oligonucleotide junction. In this case, the dependence of melting temperature on thermodynamic parameters and oligonucleotide concentration has the same form as in the case of the duplex structure formed by a pair of non-self-complementary oligonucleotides. The ability of various model approaches to describe the experimental curves of concatamer heat denaturation is evaluated. For concatamer structures used as signal amplifiers in DNA hybridization analysis, a function is introduced that shows the relative contribution of a concatamer of given length to the magnitude of signal amplification. The dependence of the maximum of this function on the concentration of oligonucleotides, the thermodynamic characteristics of their complexes, and temperature has been determined. It is shown by the gel retardation assay that the function of the length distribution of concatamers qualitatively correlates with the experimental dependences.     

alpha-DNA. VI: Comparative study of alpha- and beta-anomeric oligodeoxyribonucleotides in hybridization to mRNA and in cell free translation inhibition.

alpha and beta-anomeric d(G2T12G2) oligodeoxyribonucleotides were compared for their hybridization to rA12: the observed melting temperatures are 27 degrees C for beta-oligodeoxyribonucleotide/RNA hybrid and 53 degrees C for alpha-oligodeoxyribonucleotide/RNA. alpha-oligonucleotides with the four bases, complementary to natural mRNAs, were synthesized for the first time, labeled at their 5'-end with [32P] and used as probes in Northern blot experiments. In spite of these higher affinities for their target RNA's, they were unable to block translation of natural or synthetic mRNA's in rabbit reticulocyte lysate. We have studied the RNase H activity on model rA12:alpha- or beta-d(G2T12G2) hybrids or on mRNA:alpha- or beta-oligonucleotides hybrids. Specific hybridization protects RNA strech when using alpha-oligonucleotides but not beta-oligonucleotides. Thus, our results show the inability of RNase H to degrade RNA in alpha-oligodeoxyribonucleotides:RNA duplexes.     

Characterization of the secondary structure and stability of an RNA aptamer that binds vascular endothelial growth factor

Thermal denaturation studies and spectroscopic studies were employed to investigate the secondary structure and stability of an RNA-PEG conjugate commercially called Macugen. The RNA aptamer is conjugated to a pegylated moiety, and the majority of its 2'-hydroxyl groups are methylated or otherwise modified. UV optical melting studies and differential scanning calorimetry (DSC) were carried out under different conditions to evaluate the effects of Na+ and oligomer concentrations on the stability of the secondary structure of the RNA oligomer. The results of these studies indicated that the T(m) of the RNA is independent of oligomer concentration but dependent on the salt concentration, in a predictable fashion. Further, the DSC melting profiles obtained under all conditions were highly reversible. Circular dichroism (CD) studies were determined under different salt concentrations, various RNA concentrations, and temperatures as well. Together, the thermal denaturation and CD studies provide evidence that the secondary structure of the RNA oligonucleotide is a stable hairpin at 25 degrees C and that the thermally induced hairpin to single strand transition is highly reversible.     

Flexibility of end-labeled polymers from electron spin resonance line-shape analysis: 3' terminus of transfer ribonucleic acid and 5S ribonucleic acid

Saccharomyces cerevisiae tRNA and 5S RNA, Escherichia coli 5S RNA, and wheat germ 5S RNA have each been specifically spin-labeled at the 3'-terminal ribose to give morpholino-spin-labeled (MSL) RNAs. Enzymatic hydrolysis with pancreatic RNase, followed by anion-exchange chromatography, confirms the site of attachment of the spin-label. Effective rotational correlation times, TB and TC, have been determined from electron spin resonance (ESR) peak heights and widths as a function of temperature for each MSL RNA, and Arrhenius plots of -log T vs. 1/T have been constructed. TC is a measure of internal flexibility at the link between the label and the RNA, while TB is a measure of rotational flexibility of the RNA near the labeled site. Validity of the TB and TC determination has been confirmed from simulation of the experimental EPR spectra by theoretical spectra computed for various attachment geometries and motional rates. Discontinuities in the slope of Arrhenius plots for TB were seen at 34 and 66 degrees C (yeast MSL tRNA), 37 and 60 degrees C (E. coli MSL 5S RNA), 37 and 57 degrees C (yeast MSL 5S RNA), and 36 and 54 degrees C (wheat germ MSL 5S RNA). Temperature-induced hydrolysis of each MSL RNA was less than 5% as determined by gel-filtration chromatography. The melting curves are consistent with a recently proposed universal secondary structural model for prokaryotic and eukaryotic 5S RNA.