共查询到20条相似文献,搜索用时 31 毫秒
1.
A. V. Barkhash V. N. Babenko M. I. Voevoda A. G. Romaschenko 《Russian Journal of Genetics》2016,52(6):608-614
The DC-SIGN (dendritic cell-specific intercellular adhesion molecule (ICAM)-3-grabbing non-integrin) and TLR3 (toll-like receptor 3) proteins are key effectors of the innate immunity and particularly play an important role in the organism’s antiviral defense as pattern-recognition receptors. Previously, we demonstrated that certain genotypes and alleles of single nucleotide polymorphisms (SNPs) rs2287886 (G/A) in the promoter region of the CD209 gene (encoding DC-SIGN) and rs3775291 (G/A, Leu412Phe) in the exon 4 of the TLR3 gene are associated with human predisposition to tick-borne encephalitis in the Russian population. In the present work, the distribution of genotype and allele frequencies for these SNPs was studied in seven populations of North Eurasia, including Caucasians (Russians and Germans (from Altai region)), Central Asian Mongoloids (Altaians, Khakass, Tuvinians, and Shorians), and Arctic Mongoloids (Chukchi). It was found that the CD209 gene rs2287886 SNP A/A genotype and A allele, as well as the TLR3 gene rs3775291 SNP G/G genotype and G allele (the frequencies of which in our previous studies were increased in tick-borne encephalitis patients as compared with the population control (Russian citizens of Novosibirsk)), are preserved with a high frequency in Central Asian Mongoloids (who for a long time regularly came in contact with tick-borne encephalitis virus in places of their habitation). We suggested that predisposition to tick-borne encephalitis in Central Asian Mongoloid populations can be predetermined by a different set of genes and their polymorphisms than in the Russian population. 相似文献
2.
Objectives
Neutrophils contribute to pathogen clearance through pattern recognition receptors (PRRs) activation. However, the role of PRRs in neutrophils in both HIV-1-infected [HIV-1(+)] and HIV-1-exposed seronegative individuals (HESN) is unknown. Here, a study was carried out to evaluate the level of PRR mRNAs and cytokines produced after activation of neutrophils from HIV-1(+), HESN and healthy donors.Methods
The neutrophils were stimulated with specific agonists for TLR2, TLR4 and TLR9 in the presence of HIV-1 particles. Pro-inflammatory cytokine production, expression of neutrophil activation markers and reactive oxygen species (ROS) production were analyzed in neutrophils from HESN, HIV-1(+) and healthy donors (controls).Results
We found that neutrophils from HESN presented reduced expression of PRR mRNAs (TLR4, TLR9, NOD1, NOD2, NLRC4 and RIG-I) and reduced expression of cytokine mRNAs (IL-1β, IL-6, IL-18, TNF-α and TGF-β). Moreover, neutrophils from HESN were less sensitive to stimulation through TLR4. Furthermore, neutrophils from HESN challenged with HIV-1 and stimulated with TLR2 and TLR4 agonists, produced significantly lower levels of reactive oxygen species, versus HIV-1(+).Conclusions
A differential pattern of PRR expression and release of innate immune factors in neutrophils from HESN is evident. Our results suggest that lower neutrophil activation can be involved in protection against HIV-1 infection. 相似文献3.
Manuela Sironi Mara Biasin Federica Gnudi Rachele Cagliani Irma Saulle Diego Forni Veronica Rainone Daria Trabattoni Micaela Garziano Francesco Mazzotta Luis Miguel Real Antonio Rivero-Juarez Antonio Caruz Sergio Lo Caputo Mario Clerici 《PloS one》2014,9(9)
The HAVCR2 gene encodes TIM-3, an immunoglobulin superfamily member expressed by exhausted CD8+ T cells during chronic viral infection. We investigated whether genetic variation at HAVCR2 modulates the susceptibility to HIV-1 acquisition; specifically we focused on a 3′ UTR variant (rs4704846, A/G) that represents a natural selection target. We genotyped rs4704846 in three independent cohorts of HIV-1 exposed seronegative (HESN) individuals with different geographic origin (Italy and Spain) and distinct route of exposure to HIV-1 (sexual and injection drug use). Matched HIV-1 positive subjects and healthy controls were also analyzed. In all case-control cohorts the minor G allele at rs4704846 was more common in HIV-1 infected individuals than in HESN, with healthy controls showing intermediate frequency. Results from the three association analyses were combined through a random effect meta-analysis, which revealed no heterogeneity among samples (Cochrane''s Q, p value = 0.89, I2 = 0) and yielded a p value of 6.8 ×10−4. The minor G allele at rs4704846 was found to increase HAVCR2 expression after in vitro HIV-1 infection. Thus, a positively selected polymorphism in the 3′ UTR, which modulates HAVCR2 expression, is associated with the susceptibility to HIV-1 infection. These data warrant further investigation into the role of TIM-3 in the prevention and treatment of HIV-1/AIDS. 相似文献
4.
Mark C. Dessing Jesper Kers Jeffrey Damman Henri G. D. Leuvenink Harry van Goor Jan-Luuk Hillebrands Bouke G. Hepkema Harold Snieder Jacob van den Born Martin H. de Borst Stephan J. L. Bakker Gerjan J. Navis Rutger J. Ploeg Sandrine Florquin Marc Seelen Jaklien C. Leemans 《PloS one》2015,10(10)
Toll-like receptors (TLRs) play a crucial role in innate- and adaptive immunity. The TLR pathways were shown to play key functional roles in experimental acute and chronic kidney injury, including the allo-immune response after experimental renal transplantation. Data about the precise impact of TLRs and their negative regulators on human renal transplant outcomes however are limited and contradictory. We studied twelve non-synonymous single nucleotide polymorphisms (SNPs) of which eleven in TLR1-8 and one in SIGIRR in a final cohort comprising 1116 matching donors and recipients. TLR3 p.Leu412Phe and SIGIRR p.Gln312Arg significantly deviated from Hardy-Weinberg equilibrium and were excluded. The frequency distribution of the minor alleles of the remaining 10 TLR variants were compared between patients with end-stage renal disease (recipients) and controls (kidney donors) in a case-control study. Secondly, the associations between the minor allele frequency of the TLR variants and delayed graft function, biopsy-proven acute rejection and death-censored graft failure after transplantation were investigated with Cox regression. Carrier frequencies of the minor alleles of TLR1 p.His305Leu (OR = 4.79, 95% CI = 2.35–9.75, P = 0.0002), TLR1 p.Asn248Ser (OR = 1.26, 95% CI = 1.07–1.47, P = 0.04) and TLR8 p.Met1Val (OR = 1.37, 95% CI = 1.14–1.64, P = 0.008) were significantly higher in patients with ESRD, with little specificity for the underlying renal disease entity (adjusted for age, gender and donor-recipient relatedness). The minor allele frequency of none of the TLR variants significantly associated with the surrogate and definite outcomes, even when multivariable models were created that could account for TLR gene redundancy. In conclusion, genetic variants in TLR genes were associated with the prevalence of ESRD but not renal transplant outcomes. Therefore, our data suggests that specific TLR signaling routes might play a role in the final common pathway of primary renal injury. A role for TLR signaling in the context of renal transplantation is probably limited. 相似文献
5.
Joshua Herbeck Suvankar Ghorai Lennie Chen Charles R. Rinaldo Joseph B. Margolick Roger Detels Lisa Jacobson Steven Wolinsky James I. Mullins 《PloS one》2015,10(3)
Some individuals remain HIV-1 antibody and PCR negative after repeated exposures to the virus, and are referred to as HIV-exposed seronegatives (HESN). However, the causes of resistance to HIV-1 infection in cases other than those with a homozygous CCR5Δ32 deletion are unclear. We hypothesized that human p21WAF1/CIP1 (a cyclin-dependent kinase inhibitor) could play a role in resistance to HIV-1 infection in HESN, as p21 expression has been associated with suppression of HIV-1 in elite controllers and reported to block HIV-1 integration in cell culture. We measured p21 RNA expression in PBMC from 40 HESN and 40 low exposure HIV-1 seroconverters (LESC) prior to their infection using a real-time PCR assay. Comparing the 20 HESN with the highest exposure risk (median = 111 partners/2.5 years prior to the 20 LESC with the lowest exposure risk (median = 1 partner/2.5 years prior), p21 expression trended higher in HESN in only one of two experiments (P = 0.11 vs. P = 0.80). Additionally, comparison of p21 expression in the top 40 HESN (median = 73 partners/year) and lowest 40 LESC (median = 2 partners/year) showed no difference between the groups (P = 0.84). There was a weak linear trend between risk of infection after exposure and increasing p21 gene expression (R2 = 0.02, P = 0.12), but again only in one experiment. Hence, if p21 expression contributes to the resistance to viral infection in HESN, it likely plays a minor role evident only in those with extremely high levels of exposure to HIV-1. 相似文献
6.
Vitamin D (VitD) is an endogenous immunomodulator that could protect from HIV-1 infection reducing immune activation and inducing the expression of anti-HIV-1 peptides. To establish a correlation between VitD and natural resistance to HIV-1 infection, a case-control study using blood and mucosa samples of 58 HIV-1-exposed but seronegative (HESN) individuals, 43 HIV-1 seropositives (SPs) and 59 non-exposed healthy controls (HCs) was carried out. The VitD concentration in plasma was determined by ELISA, and mRNA relative units (RU) of VDR, IL-10, TGF-β, TNF-α and IL-1β in peripheral blood mononuclear cells (PBMCs), oral and genital mucosa was quantified by qRT-PCR. mRNA levels of human beta-defensin (HBD) -2 and -3 were previously reported and used for correlations. Significantly higher levels of VitD were found in plasma as well as higher mRNA RU of VDR in PBMCs, and in genital mucosa from HESN compared to HCs. In addition, higher mRNA RU of TNF-α, IL-1β and IL-10, and lower mRNA RU of TGF-β were found in PBMC from HESNs compared to HCs. We also observed higher IL-10 mRNA RU in genital mucosa of HESNs compared to HCs, and the mRNA levels of TNF-α in oral and genital mucosa of SPs were higher compared to HESNs. Furthermore, positive correlations between VDR and IL-10 mRNA RU in PBMCs and genital mucosa of HESNs were found. Finally, HBD-2 and HBD-3 mRNA RU were positively correlated with VDR mRNA expression in oral mucosa from HESNs. These results suggest that high levels of VitD and its receptor are associated with natural resistance to HIV-1 infection. Up-regulation of the anti-inflammatory IL-10, and the induction of anti-HIV-1 defensins in mucosa might be part of the mechanisms involved in this association. However, further studies are required to define causal associations. 相似文献
7.
8.
Background
Dendritic cell-specific intercellular adhesion molecule-3-grabbing nonintegrin related (DC-SIGNR) can bind to the human immunodeficiency virus-1 (HIV-1) gp120 envelope glycoprotein and is thus important for the host-pathogen interaction in HIV-1 infection. Studies of the association between the variable number tandem repeat (VNTR) polymorphism of the DC-SIGNR gene and HIV-1 susceptibility have produced controversial results.Methods and Findings
We conducted a meta-analysis of the data contained in the literature to clarify these findings. In total, 10 studies consisting of 2683 HIV-1 patients and 3263 controls (2130 healthy controls and 1133 HIV-1 exposed but seronegative (HESN) controls) were included. Odds ratios (ORs) with 95% confidence intervals (95% CIs) were assessed in the main analyses. Further stratified analyses by ethnicity and sample size were performed. By dividing the controls into two groups, healthy controls and HIV-1 exposed but seronegative (HESN) controls, we explored different genetic models to detect any association between the VNTR polymorphism and predisposition to HIV-1 infection. The results showed that the 5-repeat allele carriers (OR = 0.84, 95% CI = 0.73–0.96) and the 5/5 homozygous (OR = 0.68, 95% CI = 0.50–0.93) had significantly reduced risk when using the HIV-1 exposed but seronegative (HESN) as controls. The stratified analyses by ethnicity and sample size confirmed these findings. However, a low to moderate degree of heterogeneity was also found across studies.Conclusions
Our findings demonstrate that the VNTR polymorphism of the DC-SIGNR gene is associated with a moderate effect on host susceptibility to HIV-1 infection. Similar to the 32-bp deletion in the chemokine receptor-5 gene (CCR5Δ32), the DC-SIGNR VNTR 5-repeat allele might have a role in resistance to HIV infection, particularly in Asian populations. 相似文献9.
Sato K Yoshimura A Kaneko T Ukai T Ozaki Y Nakamura H Li X Matsumura H Hara Y Ogata Y 《The Journal of biological chemistry》2012,287(30):25163-25172
We have previously shown that a single nucleotide polymorphism rs11536889 in the 3'-untranslated region (UTR) of TLR4 was associated with periodontitis. In this study the effects of this single nucleotide polymorphism on Toll-like receptor (TLR) 4 expression were investigated. Monocytes from subjects with the C/C genotype expressed higher levels of TLR4 on their surfaces than those from subjects with the other genotypes. Peripheral blood mononuclear cells (PBMCs) from the C/C and G/C subjects secreted higher levels of IL-8 in response to lipopolysaccharide (LPS), a TLR4 ligand, than the cells from the G/G subjects. However, there was no significant difference in TLR4 mRNA levels in PBMCs from the subjects with each genotype. After stimulation with tripalmitoylated CSK(4) (Pam(3)CSK(4)), TLR4 mRNA levels increased in PBMCs from both the C/C and G/G subjects, whereas TLR4 protein levels increased in PBMCs from the C/C but not G/G subjects. Transient transfection of a series of chimeric luciferase constructs revealed that a fragment of 3'-UTR containing rs11536889 G allele, but not C allele, suppressed luciferase activity induced by LPS or IL-6. Two microRNAs, hsa-miR-1236 and hsa-miR-642a, were predicted to bind to rs11536889 G allele. Inhibition of these microRNAs reversed the suppressed luciferase activity. These microRNA inhibitors also up-regulated endogenous TLR4 protein on THP-1 cells (the G/G genotype) after LPS stimulation. Furthermore, mutant microRNAs that bind to the C allele inhibited the luciferase activity of the construct containing the C allele. These results indicate that genetic variation of rs11536889 contributes to translational regulation of TLR4, possibly by binding to microRNAs. 相似文献
10.
Eero Lauhkonen Petri Koponen Juho Vuononvirta Johanna Ter?sj?rvi Kirsi Nuolivirta Jyri O. Toikka Merja Helminen Qiushui He Matti Korppi 《PloS one》2016,11(1)
Aim
Toll-like receptors (TLR) play a crucial role in innate immunity, protecting the host from pathogens such as viruses. Genetic variations in TLRs have been associated with the severity of viral bronchiolitis in infancy and with the later occurrence of post-bronchiolitis asthma. The aim of the present study was to evaluate if there are any exploratory associations between TLR gene polymorphisms and lung function at 5 to 7 years of age in former bronchiolitis patients.Methods
We performed impulse oscillometry (IOS) at the median age of 6.3 years for 103 children who had been hospitalized for bronchiolitis at less than six months of age. The main parameters evaluated were airway resistance and reactance at 5Hz in baseline and post-exercise measurements. Data on single nucleotide polymorphisms (SNP) of TLR1 rs5743618, TLR2 rs5743708, TLR6 rs5743810 and TLR10 rs4129009 (TLR2 subfamily) and TLR3 rs3775291, TLR4 rs4986790, TLR7 rs179008, TLR8 rs2407992 and TLR 9 rs187084 were available for analyses.Results
The TLR4 rs4986790 wild genotype A/A was associated with a greater Rrs5 response (0.72 vs. -0.42, p = 0.03) to exercise. In TLR6 rs5743810, the minor allele T was associated with greater Rrs5 response (0.80 vs. -0.03, p = 0.04) to exercise. In TLR7 rs179008, the major allele A was associated with baseline decline in dRrs/df (-1.03 vs 0.61, p = 0.01) and increased Fres (2.28 vs. 0.89, p = 0.01) in girls.Conclusion
Among the nine studied TLRs, only TLR7 rs179008 showed some exploratory associations with post-bronchiolitis lung function deficiency, and polymorphisms of TLR4 rs4986790, and TLR6 rs5743810 in particular, with airway reactivity. These findings call for further confirmatory studies. 相似文献11.
Akshay Anand Neel Kamal Sharma Amod Gupta Sudesh Prabhakar Suresh Kumar Sharma Ramandeep Singh Pawan Kumar Gupta 《PloS one》2012,7(11)
Background
Age-related macular degeneration (AMD) is the leading cause of blindness in the elderly population. We have shown previously that mice deficient in monocyte chemoattractant protein-1 (MCP1/CCL2) or its receptor (CCR2) develop the features of AMD in senescent mice, however, the human genetic evidence so far is contradictory. We hypothesized that any dysfunction in the CCL2 and its receptor result could be the contributing factor in pathogenesis of AMD.Methods and Findings
133 AMD patients and 80 healthy controls were enrolled for this study. Single neucleotid Polymorphism for CCL2 and CCR2 was analyzed by real time PCR. CCL2 levels were determined by enzyme-linked immunosorbent assay (ELISA) after normalization to total serum protein and percentage (%) of CCR2 expressing peripheral blood mononuclear cells (PBMCs) was evaluated using Flow Cytometry. The genotype and allele frequency for both CCL2 and CCR2 was found to be significantly different between AMD and normal controls. The CCL2 ELISA levels were significantly higher in AMD patients and flow Cytometry analysis revealed significantly reduced CCR2 expressing PBMCs in AMD patients as compared to normal controls.Conclusions
We analyzed the association between single neucleotide polymorphisms (SNPs) of CCL2 (rs4586) and CCR2 (rs1799865) with their respective protein levels. Our results revealed that individuals possessing both SNPs are at a higher risk of development of AMD. 相似文献12.
《Microbes and infection / Institut Pasteur》2017,19(1):69-74
We investigated whether a 6-amino acid insertion/deletion polymorphism in the mucin domain of TIM-1 (T-cell immunoglobulin and mucin domain 1), modulates susceptibility to HIV-1 infection. The polymorphism was genotyped in three case/control cohorts of HIV-1 exposed seronegative individuals (HESN) and HIV-1 infected subjects from Italy, Peru, and Colombia; data from a Thai population were retrieved from the literature. Across all cohorts, homozygosity for the short TIM-1 allele was more common in HESNs than in HIV-1 infected subjects. A meta-analysis of the four association analyses yielded a p value of 0.005. In vitro infection assays of CD4+ T lymphocytes indicated that homozygosity for the short allele is associated with lower rate of HIV-1 replication. These results suggest that the deletion allele protects from HIV-1 infection with a recessive effect. 相似文献
13.
Kim JH Park BL Pasaje CF Kim Y Bae JS Park JS Uh ST Kim YH Kim MK Choi IS Cho SH Choi BW Koh I Park CS Shin HD 《DNA and cell biology》2012,31(6):1001-1009
Airway remodeling and exacerbated airway narrowing in asthma have been attributed to the regulation of intracellular Ca(2+) by sarcoplasmic reticulum (SR) of the airway smooth muscle cells. The protein encoded by obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) is a crucial factor in determining the SR architecture in Obscn(-/-) mice. This study genotyped a total of 55 common single-nucleotide polymorphisms (SNPs) in 592 Korean asthmatics including 163 aspirin exacerbated respiratory disease (AERD) cases and 429 aspirin-tolerant asthma (ATA) controls. Eight SNPs, including two nonsynonymous polymorphisms rs1188722C>T (Leu2116Phe) and rs1188729G>C (Cys4642Ser), and one haplotype BL2_ht1 showed statistically significant associations with AERD development (p=0.003-0.03). Two variants, rs1188722C>T (Leu2116Phe) and rs369252C>A, also revealed nominal association with FEV1 decline by aspirin provocation in asthmatics (p=0.03-0.04). Intriguingly, rs1188722C>T (Leu2116Phe) is a highly conserved amino acid residue among species, suggesting its functional relevance to AERD. In addition, the A allele of rs369252C>A, which was more prevalent in AERD than in ATA, was predicted as a potential branch point (BP) site for alternative splicing (BP score=4.29). Although further functional evaluation is required, our findings suggest that OBSCN polymorphisms, in particular, highly conserved nonsynonymous Leu2116Phe variant, might contribute to aspirin hypersensitivity in asthmatics. 相似文献
14.
Tegwinde Rebeca Compaore Serge Theophile Soubeiga Abdoul Karim Ouattara Dorcas Obiri-Yeboah Damehan Tchelougou Mamoudou Maiga Maleki Assih Cyrille Bisseye Didier Bakouan Issaka Pierre Compaore Augustine Dembele Jeremy Martinson Jacques Simpore 《PloS one》2016,11(1)
Studies on host factors, particularly the APOBEC3G gene, have previously found an association with AIDS progression in some populations and against some HIV-1 strains but not others. Our study had two main objectives: firstly, to screen a population from Burkina Faso for three variants of APOBEC3G previously described, and secondly to analyze the effect of these three variants and their haplotypes on HIV-1 infection with Circulating Recombinant Forms (CRFs) present in Burkina Faso. This case control study involved 708 seropositive and seronegative individuals. Genotyping was done by the TaqMan allelic discrimination method. Minor allele frequencies of rs6001417 (p<0.05), rs8177832 (P<0.05), and rs35228531 (P<0.001) were higher in seronegative subjects. The rs6001417 and rs8177832 SNPs were associated with HIV-1 infection in an additive model (P<0.01). Furthermore the SNP rs35228531 was also associated with HIV-1 infection in a dominant model (P<0.001). Odds ratio analysis of genotypes and alleles of the different APOBEC3G variants showed that there is a strong association between the minor genetic variants, genotype of the three SNPs, and HIV-1 status. Haplotype analysis demonstrated that rs6001417, rs8177832, and rs35228531 are in linkage disequilibrium. The haplotype GGT from the rs6001417, rs8177832 and rs35228531 respectively has a protective effect OR = 0.54 [0.43–0.68] with P<0.001. There was also associations between the haplotypes GGC OR = 1.6 [1.1;-2.3] P<0.05, and CGC OR = 5.21 [2.4–11.3] P<0.001, which increase the risk of infection by HIV-1 from almost two (2) to five (5) fold. This study demonstrates an association of rs6001417, rs8177832, and rs35228531 of APOBEC3G with HIV-1 infection in a population from Burkina Faso. 相似文献
15.
Luo M Daniuk CA Diallo TO Capina RE Kimani J Wachihi C Kimani M Bielawny T Peterson T Mendoza MG Kiazyk S Ball TB Plummer FA 《Journal of virology》2012,86(2):1166-1180
A subset of women in the Pumwani Sex Worker Cohort, established in 1985 in Nairobi, Kenya, remains uninfected despite repeated high-risk exposure (HIV-exposed, seronegative [HESN]) through active sex work. This HESN phenotype is associated with several alleles of human leukocyte antigens (HLAs) and specific CD8(+) and CD4(+) T cell responses to HIV-1. The associations of HLA alleles with differential HIV-1 infection are most likely due to their different abilities to present antigen and the different immune responses they induce. The characteristics of epitopes of HLA alleles associated with different outcomes of HIV-1 infection might therefore point to a vital clue for developing an effective vaccine. In this study, we systematically analyzed HIV-1 clade A and D Gag CD8(+) T cell epitopes of two HLA class I alleles associated with different outcomes of HIV-1 infection. Binding affinity and off-rates of the identified epitopes were determined. Gamma interferon (IFN-γ) enzyme-linked immunospot (ELISpot) assays with patient peripheral blood mononuclear cells (PBMCs) validated the epitopes. Epitope-specific CD8(+) T cells were further phenotyped for memory markers with tetramer staining. Our study showed that the protective allele A*01:01 recognizes only three Gag epitopes. By contrast, B*07:02, the allele associated with susceptibility, binds 30 epitope variants. These two alleles differ most importantly in the spectrum of Gag epitopes they can present and not in affinity, off-rates, the location of the epitopes, or epitope-specific Tem/Tcm frequencies. The binding of more epitopes and strong IFN-gamma ELISpot responses are associated with susceptibility to HIV-1 infection, while more focused antigen recognition of multiple subtypes is protective. Rational vaccine design should take these observations into account. 相似文献
16.
《Microbes and infection / Institut Pasteur》2020,22(8):371-374
Higher IL-21 levels were associated with natural resistance to HIV infection in an Italian cohort. Thus we wanted to confirm such association in HIV exposed seronegative individuals (HESN) from Colombia. Cells from HESN were less susceptible to infection and expressed higher IL-21 mRNA levels than healthy controls at both baseline and 7-days post-infection; similar results were observed for IL-6, perforin, and granzyme. These results suggest that IL-21/IL-6 increase may be a distinctive quality in the profile of HIV-1 resistance, at least during sexual exposure. However, further studies are necessary to confirm the specific protective mechanisms of these cytokines. 相似文献
17.
Lerchbaum E Trummer O Giuliani A Gruber HJ Pieber TR Obermayer-Pietsch B 《Hormones et métabolisme》2011,43(11):743-747
In a recent genome-wide association study investigating Han Chinese PCOS women 3 loci that are strongly associated with PCOS were identified on chromosome 2p16.3 (rs13405728), 2p21 (rs13429458), and 9q33.3 (rs2479106). The aim of the study was to investigate the impact of rs13405728, rs13429458, and rs2479106 variants on PCOS susceptibility in a Caucasian cohort of PCOS and control women. Metabolic, endocrine, and anthropometric measurements and oral glucose tolerance tests were performed in 545 PCOS and 317 control women. The rs13405728, rs13429458, and rs2479106 polymorphisms were genotyped. There was no significant difference in genotype frequencies of rs13405728 and rs13429458 variants between PCOS and controls. There was a trend towards an association of the rs2479106 variant with PCOS susceptibility (p=0.053). PCOS women with the rs2479106 GG genotype had significantly higher WHR than PCOS women carrying the AG and AA genotype (p=0.034 and p=0.020, respectively). Moreover, QChol/HDL and LDL levels were significantly higher in PCOS women carrying the rs2479106 GG genotype when compared to those carrying the AA genotype (p=0.024 and p=0.035, respectively). PCOS women carrying the G allele of rs13405728 had significantly higher AUCgluc, glucose-30 min, and AUCins levels than those carrying the AA genotype (p=0.039, p=0.047, and p=0.044, respectively). In PCOS women, rs13405728 genotypes are associated with glucose and insulin metabolism. Moreover, rs2479106 genotypes were associated with increased WHR levels and an adverse serum lipid profile. Further, we observed a trend towards decreased PCOS susceptibility within carriers of the rs2479106 G-allele. Further studies in large Caucasian PCOS cohorts are warranted to confirm our findings. 相似文献
18.
Arvind Kumar Singh Shantanu Prakash RK Garg Parul Jain Rashmi Kumar Amita Jain 《Bioinformation》2021,17(4):506
Host genetic factors are known to determine disease susceptibility in dengue virus infection. Therefore, in this study association of gene polymorphisms of Vitamin D Receptor [rs731236 (Taq) and rs7975232 (Apa1)], Toll-like receptor 2 [rs5743708 (Arg735Gln) and rs5743704 (Pro631His)] and Toll-like receptor 4 [rs4986790A/G(Asp299Gly13843) and rs4986791 C/T(Thr399Ile)] were studied in cases with dengue as compared to controls. Total 98 cases of confirmed dengue virus infection and 98 age, sex and geographically matched healthy controls were enrolled and their genetic polymorphisms for the above mentioned regions were studied by Sanger sequencing. Mutant genotypes CC of VDR rs731236 (Taq1) [(OR 3.808, p value =0.02, CI 1.160-12.498)], GG of VDR rs7975232 (Apa1) [(OR 3.485, p value =0.02, CI 1.162-10.45)] and heterozygous genotypes of TLR4 rs4986790 A/G Asp299Gly [OR 2.40, p value= 0.02, CI 1.12-5.14], TLR4 rs4986791 C/T Thr399Ile [OR 2.09, p value=0.02, CI 1.12-5.14] were found to be significantly more in cases with dengue virus infection as compared to the controls. Also, at these positions mutant alleles were observed in significantly higher number of cases than controls. The values for C allele at VDR rs731236 (Taq1) were OR 1.86, p value 0.009, CI 1.162-3.001; for allele G at rs7975232( Apa1) were OR 2.71, p value 0.006, CI 1.196-2.98 for allele G at TLR4s rs4986790 A/G Asp299Gly were OR 2.35, p value 0.009, CI 1.23-4.50 and for allele T at rs4986791 C/T Thr399Ile were OR 2.36, p value=0.006, CI 1.28-4.38. VDR and TLR4 but not TLR2 gene polymorphisms were found to be associated with dengue susceptibility in Indian population. 相似文献
19.
Blohmke CJ Park J Hirschfeld AF Victor RE Schneiderman J Stefanowicz D Chilvers MA Durie PR Corey M Zielenski J Dorfman R Sandford AJ Daley D Turvey SE 《Journal of immunology (Baltimore, Md. : 1950)》2010,185(12):7731-7738
New treatments are needed to improve the health of people with cystic fibrosis (CF). Reducing lung-damaging inflammation is likely to be beneficial, but specific anti-inflammatory targets have not been identified. By combining cellular immunology with a population-based genetic modifier study, we examined TLR5 as an anti-inflammatory target and modifier gene in CF. Using two pairs of human CF and control airway epithelial cells, we demonstrated that the TLR5-flagellin interaction is a major mediator of inflammation following exposure to Pseudomonas aeruginosa. To validate TLR5 as an anti-inflammatory target, we analyzed the disease modifying effects of the TLR5 c.1174C>T single nucleotide polymorphism (rs5744168) in a large cohort of CF patients (n = 2219). rs5744168 encodes a premature stop codon and the T allele is associated with a 45.5-76.3% reduction in flagellin responsiveness (p < 0.0001). To test the hypothesis that reduced TLR5 responsiveness would be associated with improved health in CF patients, we examined the relationship between rs5744168 and two clinical phenotypes: lung function and body weight. Adults with CF carrying the TLR5 premature stop codon (CT or TT genotype) had a higher body mass index than did CF patients homozygous for the fully functional allele (CC genotype) (p = 0.044); however, similar improvements in lung function associated with the T allele were not statistically significant. Although follow-up studies are needed to confirm the impact of TLR5 on nutritional status, this translational research provides evidence that genetic variation in TLR5 resulting in reduced flagellin responsiveness is associated with improved health indicators in adults with CF. 相似文献
20.
Ovsyannikova IG Haralambieva IH Vierkant RA Pankratz VS Jacobson RM Poland GA 《Human genetics》2011,130(4):547-561
Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. 相似文献