Molecular dynamics simulations of DNA and a protein-DNA complex including solvent

The results of a recent nanosecond (ns) molecular dynamics (MD) simulation of the d(CGCGAATTCGCG) double helix in water and a 100 ps MD study of the repressor-operator complex are described. The DNA simulations are analyzed in terms of the structural dynamics, fluctuations in the groove width and bending of the helical axis. The results indicate that the ns dynamical trajectory progresses through a series of three substates of B form DNA, with lifetimes of the order of hundreds of picoseconds (ps). An incipient dynamical equilibrium is evident. A comparison of the calculated axis bending with that observed in corresponding crystal structure data is presented. Simulation of the DNA in complex with the protein and that of the free DNA in solution, starting from the crystal conformation, reveal the dynamical changes that occur on complex formation.     

The effect of salt concentration on DNA conformation transition: a molecular-dynamics study

We performed three 3-ns molecular dynamics simulations of d(CGCGAATTCGCG)₂ using the AMBER 8 package to determine the effect of salt concentration on DNA conformational transitions. All the simulations were started with A-DNA, with different salt concentrations, and converged with B-DNA with similar conformational parameters. However, the dynamic processes of the three MD simulations were very different. We found that the conformation transition was slow in the solution with higher salt concentration. To determine the cause of this retardation, we performed three additional 1.5-ns simulations starting with B-DNA and with the salt concentrations corresponding to the simulations mentioned above. However, astonishingly, there was no delayed conformation evolution found in any of the three simulations. Thus, our simulation conclusion is that higher salt concentrations slows the A → B conformation transition, but have no effect on the final stable structure. Figure A-DNA and B-DNA. (a) is the canonical A-DNA, and (b) is the canonical B-DNA. Looking from the central major groove     

Assessment of the molecular dynamics structure of DNA in solution based on calculated and observed NMR NOESY volumes and dihedral angles from scalar coupling constants

To assess the accuracy of the molecular dynamics (MD) models of nucleic acids, a detailed comparison between MD-calculated and NMR-observed indices of the dynamical structure of DNA in solution has been carried out. The specific focus of our comparison is the oligonucleotide duplex, d(CGCGAATTCGCG)(2), for which considerable structural data have been obtained from crystallography and NMR spectroscopy. An MD model for the structure of d(CGCGAATTCGCG)(2) in solution, based on the AMBER force field, has been extended with a 14 ns trajectory. New NMR data for this sequence have been obtained in order to allow a detailed and critical comparison between the calculated and observed parameters. Observable two-dimensional (2D) nuclear Overhauser effect spectroscopy (NOESY) volumes and scalar coupling constants were back-calculated from the MD trajectory and compared with the corresponding NMR data. The comparison of these results indicate that the MD model is in generally good agreement with the NMR data, and shows closer accord with experiment than back-calculations based on the crystal structure of d(CGCGAATTCGCG)(2) or the canonical A or B forms of the sequence. The NMR parameters are not particularly sensitive to the known deficiency in the AMBER MD model, which is a tendency toward undertwisting of the double helix when the parm.94 force field is used. The MD results are also compared with a new determination of the solution structure of d(CGCGAATTCGCG)(2) using NMR dipolar coupling data.     

UV resonance Raman and circular dichroism studies of a DNA duplex containing an A(3)T(3) tract: evidence for a premelting transition and three-centered H-bonds.

The presence of A(n) and A(n)T(n) tracts in double-helical sequences perturbs the structural properties of DNA molecules, resulting in the formation of an alternate conformation to standard B-DNA known as B'-DNA. Evidence for a transition occurring prior to duplex melting in molecules containing A(n) tracts was previously detected by circular dichroism (CD) and calorimetric studies. This premelting transition was attributed to a conformational change from B'- to B-DNA. Structural features of A(n) and A(n)T(n) tracts revealed by X-ray crystallography include a large degree of propeller twisting of adenine bases, narrowed minor grooves, and the formation of three-centered H-bonds between dA and dT bases. We report UV resonance Raman (UVRR) and CD spectroscopic studies of two related DNA dodecamer duplexes, d(CGCAAATTTGCG)(2) (A(3)T(3)) and d(CGCATATATGCG)(2) [(AT)(3)]. These studies address the presence of three-centered H-bonds in the B' conformation and gauge the impact of these putative H-bonds on the structural and thermodynamic properties of the A(3)T(3) duplex. UVRR and CD spectra reveal that the premelting transition is only observed for the A(3)T(3) duplex, is primarily localized to the dA and dT bases, and is associated with base stacking interactions. Spectroscopic changes associated with the premelting transition are not readily detectable for the sugar-phosphate backbone or the cytosine and guanosine bases. The temperature-dependent concerted frequency shifts of dA exocyclic NH(2) and dT C4=O vibrational modes suggest that the A(3)T(3) duplex forms three-centered hydrogen bonds at low temperatures, while the (AT)(3) duplex does not. The enthalpy of this H-bond, estimated from the thermally induced frequency shift of the dT C4=O vibrational mode, is approximately 1.9 kJ/mol or 0.46 kcal/mol.     

Peculiarities of the B to A Transition of the λ Phage Regulatory Site OR3 and of Its Fragment

Abstract

Conformations of the synthetic deoxyoligonucleotide 17 base pairs long, which is an OR3 operator of λ phage, and of its 9-b.p. fragment were studied by the circular dichroism method (CD). The regions of stability of the double-stranded state were determined for these duplexes. A comparison of the CD spectra for these oligonucleotides with the CD for a lengthy DNA showed the conformation of these short DNA pieces to belong to the B-family.

A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at a TFE concentration specific for each oligonucleotide, which is supposed to stem from a B to A transition. The length of the fragment was found to affect the ability for the B-A transition. The transition into the A form is hindered by 13% TFE for the short 9-nucleotide in comparison with the 17-nucleotide. We suggest that this is due to the B form stabilization by terminal base pairs (B-phility of the ends).     

Conformational Transitions in Poly d(CGCGCGTTAATT)

Abstract

Conformational studies on poly d(CGCGCGTTAATT) in solution by circular dichroism spectroscopy are reported. The polynucleotide exhibits B conformation in sodium chloride solution and on addition of NiCl₂ a B-Z transition is observed. NiCl₂ titrations carried out in the presence of 5M NaCl show a midpoint of transition at 2.25 mM NiCl₂ and a complete (maximum conversion to Z form) transition at 16 mM NiCl₂. In 60% alcohol the polynucleotide remains in B conformation. The polynucleotide isomerizes into ψ and A conformations in the presence of spermidine and spermine respectively. The thermodynamic parameters calculated from the melting profiles using a two state model show that the polynucleotide is almost equally stable in its B and Z conformations.     

Monte-Carlo Simulation of DNA Duplex Hydration. B and B′ Conformations of Poly(dA) · Poly(dT) Have Different Hydration Shells

Abstract

Monte-Carlo simulation of poly(dA) · poly(dT) hydration by 30 water molecules per nucleotide pair has been performed. Two B-family conformations, both with a 36° helical twist but with different minor groove widths, were considered. One conformation is Arnott's standard B form, the other one is specific for poly(dA) · poly(dT) B′ form with a narrowed minor groove. The mean energies and the mean numbers of water-water and water-DNA hydrogen bonds are close for the two conformations. Nevertheless, the hydration shell of the B' form differs drastically from that of the standard B form. The water arrangement in the minor groove of the B′ form resembles the spine of hydration in the central part of Dickerson's dodecamer d(CGCGAATTCGCG). No such spine is formed in the hydration shell of the usual B form with a wider minor groove. In this conformation water bridges between adenine N3 or thymine O2 and oxygen of the sugar ring of the neighbouring nucleotide along the chain can be formed (“strings” in Dickerson's decamer d(CCAAGATTGG)).     

The crystal structure analysis of d(CGCGAASSCGCG)2, a synthetic DNA dodecamer duplex containing four 4'-thio-2'-deoxythymidine nucleotides.

The crystal structure refinement of the synthetic dodecamer d(CGCGAASSCGCG), where S = 4'-thio-2'-deoxythymidine, has converged at R=0.201 for 2605 reflections with F > 2sigma(F) in the resolution range 8.0-2.4 A for a model consisting of the dodecamer duplex and 66 water molecules. A comparison of its structure with that of the native dodecamer d(CGCGAATTCGCG) has revealed that the major differences between the two structures is a change in the conformation of the sugar-phosphate backbone in the regions at and adjacent to the positions of the modified nucleosides. Examination of the fine structural parameters for each of the structures reveals that the thiosugars adopt a C3'-exo conformation in d(CGCGAASSCGCG), rather than the approximate C1'-exo conformation found for the analogous sugars in the structure of d(CGCGAATTCGCG). The observed differences in structure between the two duplexes may help to explain the enhanced resistance to nuclease digestion of synthetic oligonucleotides containing 4'-thio-2'-deoxynucleotides.     

Increase in temperature induces the Z to B transition of poly[d(G-C)] in water-ethanol solution

An increase in temperature from 20 to 50° C results in the complete transition from the Z to B form of poly(d(G-C)], dissolved in a 55% ethanol-water solution. The transition is fully reversible and displays a slow kinetics. The transition profiles for the free polynucleotide and for that in the presence of ethidium bromide, which is known to stabilize the B form, are obtained by circular dichroism. Based on these data the enthalpy value for the B-Z transition in our conditions is estimated to be ΔH_BZ = ?0.7 $\text{kcal}\text{mol}$.     

Structure of d(CGCGAATTCGCG) in the presence of Ca(2+) ions.

The dodecamer d(CGCGAATTCGCG) was the first oligonucleotide to be crystallized as a B-DNA duplex. Its structure was analyzed in detail in the early 1980s. Here we show that, in the presence of Ca(2+), it crystallizes in a different way (R3 space group). The dodecamers form parallel columns of straight duplexes with ten base pairs in the B form. The terminal cytosines in each molecule are disordered, whereas the terminal guanines are placed in the minor groove of neighbor duplexes. The central GAATTC region is practically identical to that found in the classic structure of the same dodecamer crystallized in the P2(1)2(1)2(1) space group in the presence of Mg(2+) and spermine. Its structure is thus independent of the crystallization conditions which have been used.     

The linear dichroism of oriented helical and superhelical polymers

Expressions are derived to relate the linear dichroism of oriented helical and super-helical polymers to the vector equation describing a transition moment in a reference frame based on the position of a single monomer unit in a simple helix and the super-helix tilt angle β. The reduced dichroism of a perfectly oriented superhelical polymer, (Δε/ε)₀, is related to the reduced dichroism of a perfectly oriented helical polymer, (Δε/ε)₁, by the expression (Δε/ε)₀ = ½ (Δε/ε)₁(3 cos² β ? 1). Hence the linear dichroism of a helical polymer can be significantly altered by supercoiling. The application of the general expressions is illustrated by the derivation of specific equations which relate the dichroism of helical and superhelical DNA to the tilt and twist of the DNA bases, the directions of the transition moments within the base planes, and the superhelix tilt angle. Calculations of the reduced dichroism of perfectly oriented, non-super-helical DNA in the A and B configurations suggest that it will be difficult to distinguish between these two forms on the basis of dichroism measurements.     

Helix morphology changes in B-DNA induced by spontaneous B(I)<==>B(II) substrate interconversion

Investigations of spontaneous, i.e. not forced, B-DNA's B(I)<==>B(II) substate transitions are carried out on the d(CGCGAATTCGCG)2 EcoRI dodecamer sequence using Molecular Dynamics Simulations. Analysis of the resulting transition processes with respect to the backbone angles reveals concerted changes not only for backbone angles epsilon, zeta, and beta, but also for the 5'-delta and 5'-chi angles. For alpha and delta inside the interconverting base step, a change is seen in short lived B(II) conformers. With respect to base morphology distinct changes are observed for buckle, propeller twist, shift, roll and twist, as well as x-displacement and tip. The base mainly involved in the changes is identified as the base preceding the interconverting phosphate. Altogether single B(I)<==>B(II) interconversions result only in local distortions represented by the larger spread of most parameters. Comparison of the atomic positional fluctuations derived from the simulation with those obtained from the static X-ray structure results in striking similarities.     

A 5-nanosecond molecular dynamics trajectory for B-DNA: analysis of structure, motions, and solvation.

We report the results of four new molecular dynamics (MD) simulations on the DNA duplex of sequence d(CGCGAATTCGCG)2, including explicit consideration of solvent water, and a sufficient number of Na+ counterions to provide electroneutrality to the system. Our simulations are configured particularly to characterize the latest MD models of DNA, and to provide a basis for examining the sensitivity of MD results to the treatment of boundary conditions, electrostatics, initial placement of solvent, and run lengths. The trajectories employ the AMBER 4.1 force field. The simulations use particle mesh Ewald summation for boundary conditions, and range in length from 500 ps to 5.0 ns. Analysis of the results is carried out by means of time series for conformationalm, helicoidal parameters, newly developed indices of DNA axis bending, and groove widths. The results support a dynamically stable model of B-DNA for d(CGCGAATTCGCG)2 over the entire length of the trajectory. The MD results are compared with corresponding crystallographic and NMR studies on the d(CGCGAATTCGCG)2 duplex, and placed in the context of observed behavior of B-DNA by comparisons with the complete crystallographic data base of B-form structures. The calculated distributions of mobile solvent molecules, both water and counterions, are displayed. The calculated solvent structure of the primary solvation shell is compared with the location of ordered solvent positions in the corresponding crystal structure. The results indicate that ordered solvent positions in crystals are roughly twice as structured as bulk water. Detailed analysis of the solvent dynamics reveals evidence of the incorporation of ions in the primary solvation of the minor groove B-form DNA. The idea of localized complexation of otherwise mobile counterions in electronegative pockets in the grooves of DNA helices introduces an additional source of sequence-dependent effects on local conformational, helicoidal, and morphological structure, and may have important implications for understanding the functional energetics and specificity of the interactions of DNA and RNA with regulatory proteins, pharmaceutical agents, and other ligands.     

The Left-Handed Z-DNA Conformation in Oligodeoxynucleotides Containing Different Amounts of AT Base Pairs: A Far UV Circular Dichroism Study

Abstract

A number of fully self-complementary oligodeoxynucleotides have been synthesized and examined for their ability to assume the left-handed Z-DNA conformation in high salt solutions. The B- and Z-forms are identified by circular dichroism spectra, covering both the long-(220–300 nm) and short-wavelength (185–220 nm) regions, the latter showing CD bands very useful for identifying the sense of the helix winding. The main results of the study can be summarized as follows:

a) sequences composed by AT and CG blocks do support the B to Z transition, even when the AT contents amounts to 50%;

b) the occurrence of consecutive purine-purine or pyrimidine-pyrimidine dyads does not inhibit the B to Z transition, although a stronger reduction of water activity is required;

c) (AC)_n and (GT)_n containing oligonucleotides do undergo the B to Z transition in solution;

d) a millimolar quantity of Ni²⁺ concomitant with 5 M NaC10₄ is found to be very effective in bringing about the B to Z transition in most of the sequences considered in this study.     

Peculiarities of the B to A transition of the lambda phage regulatory site OR3 and of its fragment

Conformations of the synthetic deoxyoligonucleotide 17 base pairs long, which is an OR3 operator of lambda phage, and of its 9-b.p. fragment were studied by the circular dichroism method (CD). The regions of stability of the double-stranded state were determined for these duplexes. A comparison of the CD spectra for these oligonucleotides with the CD for a lengthy DNA showed the conformation of these short DNA pieces to belong to the B-family. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at a TFE concentration specific for each oligonucleotide, which is supposed to stem from a B to A transition. The length of the fragment was found to affect the ability for the B-A transition. The transition into the A form is hindered by 13% TFE for the short 9-nucleotide in comparison with the 17-nucleotide. We suggest that this is due to the B form stabilization by terminal base pairs (B-phility of the ends).     

Shape readout of AT‐rich DNA by carbohydrates

Gene expression can be altered by small molecules that target DNA; sequence as well as shape selectivities are both extremely important for DNA recognition by intercalating and groove‐binding ligands. We have characterized a carbohydrate scaffold (1) exhibiting DNA “shape readout” properties. Thermodynamic studies with 1 and model duplex DNAs demonstrate the molecule's high affinity and selectivity towards B* form (continuous AT‐rich) DNA. Isothermal titration calorimetry (ITC), circular dichroism (CD) titration, ultraviolet (UV) thermal denaturation, and Differential Scanning Calorimetry were used to characterize the binding of 1 with a B* form AT‐rich DNA duplex d[5′‐G₂A₆T₆C₂‐3′]. The binding constant was determined using ITC at various temperatures, salt concentrations, and pH. ITC titrations were fit using a two‐binding site model. The first binding event was shown to have a 1:1 binding stoichiometry and was predominantly entropy‐driven with a binding constant of approximately 10⁸ M^?1. ITC‐derived binding enthalpies were used to obtain the binding‐induced change in heat capacity (ΔC_p) of ?225 ± 19 cal/mol·K. The ionic strength dependence of the binding constant indicated a significant electrolytic contribution in ligand:DNA binding, with approximately four to five ion pairs involved in binding. Ligand 1 displayed a significantly higher affinity towards AT‐tract DNA over sequences containing GC inserts, and binding experiments revealed the order of binding affinity for 1 with DNA duplexes: contiguous B* form AT‐rich DNA (d[5′‐G₂A₆T₆C₂‐3′]) >B form alternate AT‐rich DNA (d[5′‐G₂(AT)₆C_2‐3′]) > A form GC‐rich DNA (d[5′‐A₂G₆C₆T₂‐3′]), demonstrating the preference of ligand 1 for B* form DNA. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 720–732, 2014.     

Spectroscopic detection of β ‐sheet structure in nascent Aβ oligomers

Deep‐UV resonance Raman (UVRR) spectroscopy and circular dichroism (CD) were employed to study the secondary structure of Aβ(1–42) in fresh samples with increasing fractions of oligomeric peptide. A feature with a minimum at ～217 nm appeared in CD spectra of samples containing oligomeric Aβ(1–42). UVRR spectra more closely resembled those of disordered proteins. The primary difference between UVRR spectra was the ratio of the 1236 cm^–1 to 1260 cm^–1 amide III peak intensities, which shifted in favor of the 1236 cm^–1 band as the fraction of oligomeric peptide increased. (© 2011 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim)     

Influence of Spermine on DNA Conformation in a Molecular Dynamics Trajectory of d(CGCGAATTCGCG)2: Major Groove Binding by One Spermine Molecule Delays the A→B Transition

Abstract

The effect of spermine on the A-DNA to B-DNA transition in d(CGCGAATTCGCG)₂ has been investigated by five A-start molecular dynamics simulations, using the Cornell et al. potential. In the absence of spermine an A→B transition is initiated immediately and the DNA becomes equidistant from the A- and B-forms at 200ps. In three DNA-spermine simulations, when a spermine is located across the major groove of A-DNA in one of three different initial locations, the time taken to reach equidistance from the A- and B-forms is delayed until 800, 950 or 1000ps. In each case the A-form appears to be temporarily stabilized by spermine's electrostatic interactions with phosphates on both sides of the major groove. The onset of the A→B transition can be correlated with the spermine losing contact with phosphates on one side of the groove and with A-like → B-like sugar pucker transitions in the vicinity of the spermine bridge. However in the fifth trajectory, in which the spermine initially threads from the major groove via the backbone into the minor groove, the B→A transition occurs rapidly once again and the DNA is equidistant between the A- and B-forms within 300ps. This indicates that the mere presence of spermine is insufficient to delay the transition and that major groove binding stabilizes A-DNA.     

Secondary structure polymorphism in Oxytricha nova telomeric DNA

Tandem repeats of the telomeric DNA sequence d(T₄G₄) of Oxytricha nova are capable of forming unusually stable secondary structures incorporating Hoogsteen hydrogen bonding interactions. The biological significance of such DNA structures is supported by evidence of specific recognition of telomere end-binding proteins in the crystal state. To further characterize structural polymorphism of Oxytricha telomeric DNAs, we have obtained and interpreted Raman, ultraviolet resonance Raman (UVRR) and circular dichroism (CD) spectra of the tandem repeats d(G₄T₄G₄) (Oxy1.5), d(T₄G₄)₂ (Oxy2) and dT₆(T₄G₄)₂ (T6Oxy2) and related non-telomeric isomers in aqueous salt solutions. Raman markers of Oxy1.5 identify both C2′-endo/anti and C2′-endo/syn conformations of the deoxyguanosine residues and Hoogsteen hydrogen bonded guanine quartets, consistent with the quadruplex fold determined previously by solution NMR spectroscopy. Raman, UVRR and CD signatures and Raman dynamic measurements, to monitor imino NH→ND exchanges, show that the Oxy1.5 antiparallel quadruplex fold is distinct from the hairpin structures of Oxy2 and T6Oxy2, single-stranded structures of d(TG)₈ and dT₆(TG)₈ and previously reported quadruplex structures of d(T₄G₄)₄ (Oxy4) and dG₁₂. Spectral markers of the telomeric and telomere-related DNA structures are tabulated and novel Raman and UVRR indicators of thymidine and deoxyguanosine conformations are identified. The results will be useful for probing structures of Oxytricha telomeric repeats in complexes with telomere end-binding proteins.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.