Molecular dynamics and principal components of potassium binding with human telomeric intra-molecular G-quadruplex

Telomere assumes intra-molecular G-quadruplex that is a significant drug target for inhibiting telomerase maintenance of telomeres in cancer. Metal cations have been recognized as playing important roles in stabilizing G-quadruplex, but their binding processes to human telomeric G-quadruplex remain uncharacterized. To investigate the detailed binding procedures, molecular dynamics simulations were conducted on the hybrid [3+ 1] form-one human telomeric intra-molecular G-quadruplex. We show here that the binding of a potassium ion to a G-tetrad core is mediated by two alternative pathways. Principal component analysis illustrated the dominant concerted motions of G-quadruplex occurred at the loop domains. MM-PBSA calculations revealed that binding was energetically favorable and driven by the electrostatic interactions. The lower binding site was found more constructive favorable for binding. Our data provide useful information on a potassium-mediated stable structure of human telomeric intra-molecular G-quadruplex, implicating in ion disorder associated conformational changes and targeted drug design.     

Binding properties of human telomeric quadruplex multimers: a new route for drug design

Human telomeric G-quadruplex structures are known to be promising targets for an anticancer therapy. In the past decade, several research groups have been focused on the design of new ligands trying to optimize the interactions between these small molecules and the G-quadruplex motif. In most of these studies, the target structures were the single quadruplex units formed by short human DNA telomeric sequences (typically 21-26 nt). However, the 3′-terminal single-stranded human telomeric DNA is actually 100-200 bases long and can form higher-order structures by clustering several consecutive quadruplex units (multimers). Despite the increasing number of structural information on longer DNA telomeric sequences, very few data are available on the binding properties of these sequences compared with the shorter DNA telomeric sequences.In this paper we use a combination of spectroscopic (CD, UV and fluorescence) and calorimetric techniques (ITC) to compare the binding properties of the (TTAGGG)₈TT structure formed by two adjacent quadruplex units with the binding properties of the (AG₃TT)₄ single quadruplex structure. The three side-chained triazatruxene derivative azatrux and TMPyP4 cationic porphyrin were used as quadruplex ligands. We found that, depending on the drug, the number of binding sites per quadruplex unit available in the multimer structure was smaller or greater than the one expected on the basis of the results obtained from individual quadruplex binding studies. This work suggests that the quadruplex units along a multimer structure do not behave as completely independent. The presence of adjacent quadruplexes results in a diverse binding ability not predictable from single quadruplex binding studies. The existence of quadruplex-quadruplex interfaces in the full length telomeric overhang may provide an advantageous factor in drug design to enhance both affinity and selectivity for DNA telomeric quadruplexes.     

Polymorphism of human telomeric quadruplex structures

Human telomeric DNA consists of tandem repeats of the sequence d(TTAGGG). Compounds that can stabilize the intramolecular DNA G-quadruplexes formed in the human telomeric sequence have been shown to inhibit the activity of telomerase and telomere maintenance, thus the telomeric DNA G-quadruplex has been considered as an attractive target for cancer therapeutic intervention. Knowledge of intramolecular human telomeric G-quadruplex structure(s) formed under physiological conditions is important for structure-based rational drug design and thus has been the subject of intense investigation. This review will give an overview of recent progress on the intramolecular human telomeric G-quadruplex structures formed in K(+) solution. It will also give insight into the structure polymorphism of human telomeric sequences and its implications for drug targeting.     

Conformational dynamics of the human propeller telomeric DNA quadruplex on a microsecond time scale

The human telomeric DNA sequence with four repeats can fold into a parallel-stranded propeller-type topology. NMR structures solved under molecular crowding experiments correlate with the crystal structures found with crystal-packing interactions that are effectively equivalent to molecular crowding. This topology has been used for rationalization of ligand design and occurs experimentally in a number of complexes with a diversity of ligands, at least in the crystalline state. Although G-quartet stems have been well characterized, the interactions of the TTA loop with the G-quartets are much less defined. To better understand the conformational variability and structural dynamics of the propeller-type topology, we performed molecular dynamics simulations in explicit solvent up to 1.5 μs. The analysis provides a detailed atomistic account of the dynamic nature of the TTA loops highlighting their interactions with the G-quartets including formation of an A:A base pair, triad, pentad and hexad. The results present a threshold in quadruplex simulations, with regards to understanding the flexible nature of the sugar-phosphate backbone in formation of unusual architecture within the topology. Furthermore, this study stresses the importance of simulation time in sampling conformational space for this topology.     

Loop flexibility in human telomeric quadruplex small-molecule complexes

Quadruplex nucleic acids can be formed at the ends of eukaryotic chromosomes. Their formation and stabilisation by appropriate small molecules can be used as a means of inhibiting the telomere maintenance functions of telomerase in human cancer cells. The crystal structures have been determined for a number of complexes between these small molecules and human telomeric DNA and RNA quadruplexes. The detailed structural characteristics of these complexes have been surveyed here and the variations in conformation for the TTA and UUA loops have been explored. Loop conformations have been classified in terms of a number of discrete types and their distribution among the crystal structures. Sugar conformation and backbone angles have also been examined and trends highlighted. One particular loop class has been found to be most prevalent. Implications for in particular, rational drug design, are discussed.     

Novel trisubstituted acridines as human telomeric quadruplex binding ligands

A novel series of trisubstituted acridines were synthesized with the aim of mimicking the effects of BRACO19. These compounds were synthesized by modifying the molecular structure of BRACO19 at positions 3 and 6 with heteroacyclic moieties. All of the derivatives presented in the study exhibited stabilizing effects on the human telomeric DNA quadruplex. UV–vis spectroscopy, circular dichroism, linear dichroism and viscosimetry were used in order to study the nature of the DNA binding in more detail. The results show that all of the novel derivatives were able to fold the single-stranded DNA sequences into antiparallel G-quadruplex structures, with derivative 15 exhibiting the highest stabilizing capability. Cell cycle analysis revealed that a primary trend of the “braco”-like derivatives was to arrest the cells in the S- and G₂M-phases of the cell cycle within the first 72 h, with derivative 13 and BRACO19 proving particularly effective in suppressing cell proliferation. All studies derivatives were less toxic to human fibroblast cell line in comparison with HT 29 cancer cell line.     

Linkage of cation binding and folding in human telomeric quadruplex DNA

Formation of DNA quadruplexes requires monovalent cation binding. To characterize the cation binding stoichiometry and linkage between binding and folding, we carried out KCl titrations of Tel22 (d[A(GGGTTA)₃]), a model of the human telomere sequence, using a fluorescent indicator to determine [K⁺]_free and circular dichroism to assess the extent of folding. At [K⁺]_free = 5 mM (sufficient for > 95% folding), the apparent binding stoichiometry is 3K⁺/Tel22; at [K⁺]_free = 20 mM, it increased to 8-10K⁺/Tel22. Thermodynamic analysis shows that at [K⁺]_free = 5 mM, K⁺ binding contributes approximately − 4.9 kcal/mol for folding Tel22. The overall folding free energy is − 2.4 kcal/mol, indicating that there are energetically unfavorable contributions to folding. Thus, quadruplex folding is driven almost entirely by the energy of cation binding with little or no contribution from other weak molecular interactions.     

A principal components analysis of human odontometrics

It has long been recognized that tooth crown diameters in hominoids are all positively intercorrelated one with another. This study reports on sex-specific correlation matrices derived from 2,650 individuals from the Solomon Islands, Melanesia. Mesiodistal and buccolingual diameters of all permanent teeth from one side are used, excluding third molars. Analysis discloses significant sex dimorphism in the strengths of the intercorrelations, with females being better integrated. Principal components analysis (PCA) provides an objective means of data reduction (shown here to be preferable to simple size summation methods) and decorrelation of the resulting linear combinations. Four components are extracted (with results being virtually identical in the two sexes) and arguments are put forth that varimax rotation to "a simpler solution" may be counterproductive. Before rotation, the four components are 1) overall size, 2) buccolingual widths contrasted with mesiodistal lengths, 3) anterior (I,C) contrasted with posterior (P,M) teeth, and 4) premolars contrasted with molars. Most of the explained (shared) variance (63%) extracted by PCA is in overall size of the dentition. There is a strong urge to view the results of these principal components analyses as reflective of biologically and genetically meaningful entities.     

Intramolecular quadruplex conformation of human telomeric DNA assessed with 125I-radioprobing

A repeated non-coding DNA sequence d(TTAGGG)_n is present in the telomeric ends of all human chromosomes. These repeats can adopt multiple inter and intramolecular non-B-DNA conformations that may play an important role in biological processes. Two intramolecular structures of the telomeric oligonucleotide dAGGG(TTAGGG)₃, antiparallel and parallel, have been solved by NMR and X-ray crystallography. In both structures, the telomeric sequence adopts an intramolecular quadruplex structure that is stabilized by G-4 quartets, but the ways in which the sequence folds into the quadruplex are different. The folds of the human telomeric DNA were described as an anti-parallel basket-type and a parallel propeller-type. We applied ¹²⁵I-radioprobing to determine the conformation of the telomeric quadruplex in solution, in the presence of either Na⁺ or K⁺ ions. The probability of DNA breaks caused by decay of ¹²⁵I is inversely related to the distance between the radionuclide and the sugar unit of the DNA backbone; hence, the conformation of the DNA backbone can be deduced from the distribution of breaks. The probability of breaks measured in the presence of Na⁺ and K⁺ were compared with the distances in basket-type and propeller-type quadruplexes obtained from the NMR and crystal structures. Our radioprobing data demonstrate that the antiparallel conformation was present in solution in the presence of both K⁺ and Na⁺. The preferable conformation in the Na⁺-containing solution was the basket-type antiparallel quadruplex whereas the presence of K⁺ favored the chair-type antiparallel quadruplex. Thus, we believe that the two antiparallel and the parallel conformations may coexist in solution, and that their relative proportion is determined by the type and concentration of ions.     

Effect of cationic comb-type copolymer on quadruplex folding of human telomeric DNA

Cationic comb-type copolymer (CCC) consisting of a polycationic backbone and abundant graft water-soluble chains exhibited considerable stabilization effect on DNA hybrids, such as double- and triple-stranded DNAs. Here, we describe the effect of CCC on antiparallel G-quadruplex folding of human telomeric DNA, d(GGGTTA)(n) in the presence of sodium ions. CCC did not significantly alter the circular dichroism (CD) spectra of d((GGGTTA)(3)GGG) and d((GGGTTA)(7)GGG) indicating that the CCC did not influence the antiparallel folding of the telomeric repeats. Hence, the ionic interaction of CCC with the DNA sequence did not interfere with specific interaction of the DNA with sodium ions to form G-quartets. Interestingly, CCC did not change the melting temperature of the d((GGGTTA)(3)GGG) suggesting negligible stabilizing effect of CCC on the antiparallel quadruplex structure.     

Binding of berberine to human telomeric quadruplex - spectroscopic, calorimetric and molecular modeling studies

This study examines the characteristics of binding of berberine to the human telomeric d[AG(3)(T(2)AG(3))(3)] quadruplex. By employing UV-visible spectroscopy, fluorescence spectroscopy and isothermal titration calorimetry, we found that the binding affinity of berberine to the human telomeric quadruplex is 10(6). The complete thermodynamic profile for berberine binding to the quadruplex, at 25 degrees C, shows a small negative enthalpy (DeltaH) of -1.7 kcal.mol(-1), an entropy change with TDeltaS of +6.5 kcal.mol(-1), and an overall favorable free energy (DeltaG) of -8.2 kcal.mol(-1) .Through the temperature dependence of DeltaH, we obtained a heat capacity (DeltaC(p)) of -94 (+/- 5) cal.mol(-1).K(-1). The osmotic stress method revealed that there is an uptake of 13 water molecules in the complex relative to the free reactants. Furthermore, the molecular modeling studies on different quadruplex-berberine complexes show that berberine stacking at the external G-quartet is mainly aided by the pi-pi interaction and the stabilization of the high negative charge density of O6 of guanines by the positively charged N7 of berberine. The theoretical heat capacity (DeltaC(p)) values for quadruplex-berberine models are -89 and -156 cal.mol(-1).K(-1).     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Molecular dynamics simulations of Guanine quadruplex loops: advances and force field limitations

A computational analysis of d(GGGGTTTTGGGG)(2) guanine quadruplexes containing either lateral or diagonal four-thymidine loops was carried out using molecular dynamics (MD) simulations in explicit solvent, locally enhanced sampling (LES) simulations, systematic conformational search, and free energy molecular-mechanics, Poisson Boltzmann, surface area (MM-PBSA) calculations with explicit inclusion of structural monovalent cations. The study provides, within the approximations of the applied all-atom additive force field, a qualitatively complete analysis of the available loop conformational space. The results are independent of the starting structures. Major conformational transitions not seen in conventional MD simulations are observed when LES is applied. The favored LES structures consistently provide lower free energies (as estimated by molecular-mechanics, Poisson Boltzmann, surface area) than other structures. Unfortunately, the predicted optimal structure for the diagonal loop arrangement differs substantially from the atomic resolution experiments. This result is attributed to force field deficiencies, such as the potential misbalance between solute-cation and solvent-cation terms. The MD simulations are unable to maintain the stable coordination of the monovalent cations inside the diagonal loops as reported in a recent x-ray study. The optimal diagonal and lateral loop arrangements appear to be close in energy although a proper inclusion of the loop monovalent cations could stabilize the diagonal architecture.     

Investigation of inversion polymorphisms in the human genome using principal components analysis

Despite the significant advances made over the last few years in mapping inversions with the advent of paired-end sequencing approaches, our understanding of the prevalence and spectrum of inversions in the human genome has lagged behind other types of structural variants, mainly due to the lack of a cost-efficient method applicable to large-scale samples. We propose a novel method based on principal components analysis (PCA) to characterize inversion polymorphisms using high-density SNP genotype data. Our method applies to non-recurrent inversions for which recombination between the inverted and non-inverted segments in inversion heterozygotes is suppressed due to the loss of unbalanced gametes. Inside such an inversion region, an effect similar to population substructure is thus created: two distinct "populations" of inversion homozygotes of different orientations and their 1:1 admixture, namely the inversion heterozygotes. This kind of substructure can be readily detected by performing PCA locally in the inversion regions. Using simulations, we demonstrated that the proposed method can be used to detect and genotype inversion polymorphisms using unphased genotype data. We applied our method to the phase III HapMap data and inferred the inversion genotypes of known inversion polymorphisms at 8p23.1 and 17q21.31. These inversion genotypes were validated by comparing with literature results and by checking Mendelian consistency using the family data whenever available. Based on the PCA-approach, we also performed a preliminary genome-wide scan for inversions using the HapMap data, which resulted in 2040 candidate inversions, 169 of which overlapped with previously reported inversions. Our method can be readily applied to the abundant SNP data, and is expected to play an important role in developing human genome maps of inversions and exploring associations between inversions and susceptibility of diseases.     

Folding thermodynamics of the hybrid‐1 type intramolecular human telomeric G‐quadruplex

Guanine‐rich DNA sequences that may form G‐quadruplexes are located in strategic DNA loci with the ability to regulate biological events. G‐quadruplexes have been under intensive scrutiny owing to their potential to serve as novel drug targets in emerging anticancer strategies. Thermodynamic characterization of G‐quadruplexes is an important and necessary step in developing predictive algorithms for evaluating the conformational preferences of G‐rich sequences in the presence or the absence of their complementary C‐rich strands. We use a combination of spectroscopic, calorimetric, and volumetric techniques to characterize the folding/unfolding transitions of the 26‐meric human telomeric sequence d[A₃G₃(T₂AG₃)₃A₂]. In the presence of K⁺ ions, the latter adopts the hybrid‐1 G‐quadruplex conformation, a tightly packed structure with an unusually small number of solvent‐exposed atomic groups. The K⁺‐induced folding of the G‐quadruplex at room temperature is a slow process that involves significant accumulation of an intermediate at the early stages of the transition. The G‐quadruplex state of the oligomeric sequence is characterized by a larger volume and compressibility and a smaller expansibility than the coil state. These results are in qualitative agreement with each other all suggesting significant dehydration to accompany the G‐quadruplex formation. Based on our volume data, 432 ± 19 water molecules become released to the bulk upon the G‐quadruplex formation. This large number is consistent with a picture in which DNA dehydration is not limited to water molecules in direct contact with the regions that become buried but involves a general decrease in solute–solvent interactions all over the surface of the folded structure. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 216–227, 2014.     

Permutation-validated principal components analysis of microarray data

Background  

In microarray data analysis, the comparison of gene-expression profiles with respect to different conditions and the selection of biologically interesting genes are crucial tasks. Multivariate statistical methods have been applied to analyze these large datasets. Less work has been published concerning the assessment of the reliability of gene-selection procedures. Here we describe a method to assess reliability in multivariate microarray data analysis using permutation-validated principal components analysis (PCA). The approach is designed for microarray data with a group structure.