Molecular basis for the temperature-dependent insolubility of cryoglobulins. X. The amino acid sequence of the heavy chain variable region of McE

The amino acid sequence of the VH region of McE, a monoclonal IgM cryoimmunoglobulin, has been determined employing automated sequencing methodology. Digestion of the intact Fab mu component, derived by trypsin cleavage of the parent protein at elevated temperature with CNBr, followed by complete reduction and alkylation, yielded the intact light chain as well as the 2 CNBr fragments that constituted the VH. N-terminal sequencing of the larger unblocked CNBr fragment, along with a component fragment derived by cleavage by BNPS-Skatole, established the structure of the VH from position 88 through the V leads to C switch region. Citraconylation of the smaller, blocked fragment effected sufficient solubilization for enzymatic deblocking and direct sequencing of the N-terminal 20 residues of the VH. Complete trypsin digestion of the N-terminal CNBr fragment yielded 9 peptides that could be isolated by preparative cation exchange chromatography and gel filtration. The complete sequence of these peptides along with 4 chymotryptic peptides completed the primary structure of the VH region. The primary structure of McE appears to resemble that of He, previously identified as belonging to the VH II subgroup. The presence of characteristic CDR and FR regions as well as the identification of a probable site of glycosylation suggest that the cryoimmunoglobulin closely resembles noncryoglobulins in terms of overall structural composition. The cryoglobulin property may arise through alterations in individual residues or unfavorable arrangements of CDR and FR segments.     

Purification and sequencing of cyanogen bromide fragments from ribulosebisphosphate carboxylase/oxygenase from Rhodospirillum rubrum

As a part of the goal to determine the total sequence of Rhodospirillum rubrum ribulosebisphosphate carboxylase/oxygenase, the cyanogen bromide fragments were fractionated and sequenced (or partially sequenced). Twelve of the anticipated 14 peptides were obtained in highly purified form. The other two peptides were located, respectively, within a trytophanyl cleavage product (which overlapped with four CNBr fragments) and within an active-site peptide characterized earlier (which overlapped with three CNBr fragments). These overlaps coupled with amino and carboxyl terminal sequence information of the intact subunit and the availability of the sequence of the corresponding enzyme from higher plants permitted alignment of all fragments. Eight CNBr peptides were sequenced completely; four of the CNBr peptides consisted of more than 80 residues and were only partially sequenced as permitted by direct Edman degradation. Of the approximate 475 residues per subunit, 339 were placed in sequence. The lack of extensive conservation of primary structure between R. rubrum and higher plant carboxylases permits the tentative identifications of those regions likely to be functionally important.     

Structure and function of L-lactate dehydrogenases from thermophilic and mesophilic bacteria, V. The complete amino-acid sequence of the mesophilic L-lactate dehydrogenase from Bacillus megaterium

The complete amino-acid sequence of L-lactate-dehydrogenase from the mesophilic Bacillus megaterium was determined. 92% of the 318 amino acids were established by sequence analysis of the N-terminus, of four CNBr fragments and of one fragment obtained by cleavage with BNPS-skatole. The primary structure was completed by sequencing overlapping fragments obtained by further cleavage of suitable CNBr fragments and BNPS fragments with either trypsin, endoproteinase Lys-C, o-iodosobenzoic acid or hydroxylamine. The C-terminal amino acids were determined by degradation with carboxypeptidase A. The sequence homology between lactate dehydrogenases from B. megaterium and those from other Bacilli is 59-61% and 35-37% to those from higher organisms. The high sequence homology among lactate dehydrogenases from Bacilli, adapted to different temperatures, allows comparative studies of the structural basis of protein thermostability.     

The primary structure of human plasma high density apolipoprotein glutamine I (ApoA-I). II. The amino acid sequence and alignment of cyanogen bromide fragments IV, III, and I.

Apolipoprotein glutamine I (apoLP-Gln-I or apoA-I) is the major protein constituent of the human plasma high density lipoproteins. Cleavage of this protein with cyanogen bromide yields four fragments, designated in the order of elution from Bio-Gel P-30 as CNBr I, II, III, and IV. In the first paper in this series, the amino acid sequence of the NH2-terminal fragment, CNBr II, is reported. In the present study, CNBr IV, III, and I, containing, respectively, 25, 36, and 94 amino acids were sequenced by conventional means. To establish the alignment of the cyanogen bromide fragments, apoLP-Gln-I was digested with trypsin and two of the three methionine-containing tryptic peptides were isolated. The amino acid sequence of apoLP-Gln-I is as follows: (see article). With the complete amino acid sequence available, a CPK space-filling model of apoLP-Gln-I was constructed. The protein was placed into an alpha helical conformation wherever the primary structure permitted. Thirteen helical regions were identified. These regions account for 70% of the amino acid residues of the protein. Each helix is characterized as having two faces (amphipathic). One is a polar face that occupies approximately 180 degrees of the surface of the helix and the other is a hydrophobic face that occupies the other 180 degrees of the helical surface. Similar amphipathic helices have been identified previously in the other lipoprotein-proteins that have known sequences. It is suggested that the amphipathic helical regions of apoLP-Gln-I are important in the binding of phospholipids in high density lipoproteins.     

Acanthamoeba actin and profilin can be cross-linked between glutamic acid 364 of actin and lysine 115 of profilin

Acanthamoeba profilin was cross-linked to actin via a zero-length isopeptide bond using carbodiimide. The covalently linked 1:1 complex was purified and treated with cyanogen bromide. This cleaves actin into small cyanogen bromide (CNBr) peptides and leaves the profilin intact owing to its lack of methionine. Profilin with one covalently attached actin CNBr peptide was purified by gel filtration followed by gel electrophoresis and electroblotting on polybase-coated glass-fiber membranes. Since the NH2 terminus of profilin is blocked, Edman degradation gave only the sequence of the conjugated actin CNBr fragment beginning with Trp-356. The profilin-actin CNBr peptide conjugate was digested further with trypsin and the cross-linked peptide identified by comparison with the tryptic peptide pattern obtained from carbodiimide-treated profilin. Amino-acid sequence analysis of the cross-linked tryptic peptides produced two residues at each cycle. Their order corresponds to actin starting at Trp-356 and profilin starting at Ala-94. From the absence of the phenylthiohydantoin-amino acid residues in specific cycles, we conclude that actin Glu-364 is linked to Lys-115 in profilin. Experiments with the isoforms of profilin I and profilin II gave identical results. The cross-linked region in profilin is homologous with sequences in the larger actin filament capping proteins fragmin and gelsolin.     

Structure of the high-affinity binding site for noncompetitive blockers of the acetylcholine receptor: [3H]chlorpromazine labels homologous residues in the beta and delta chains

The membrane-bound acetylcholine receptor from Torpedo marmorata was photolabeled by the noncompetitive channel blocker [3H]chlorpromazine under equilibrium conditions in the presence of the agonist carbamoylcholine. The amount of radioactivity incorporated into all subunits was reduced by addition of phencyclidine, a specific ligand for the high-affinity site for noncompetitive blockers. The labeled beta chain was purified and digested with trypsin or CNBr, and the resulting fragments were fractionated by high-performance liquid chromatography. Sequence analysis resulted in the identification of Ser-254 and Leu-257 as residues labeled by [3H]chlorpromazine in a phencyclidine-sensitive manner. These residues are located in the hydrophobic and potentially transmembrane segment M II of the beta chain, a region homologous to that containing the chlorpromazine-labeled Ser-262 in the delta chain [Giraudat, J., Dennis, M., Heidmann, T., Chang, J. Y., & Changeux, J.-P. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 2719-2723]. These results show that homologous regions of different receptor subunits contribute to the unique high-affinity site for noncompetitive blockers, a finding consistent with the location of this site on the axis of symmetry of the receptor molecule.     

Complete amino acid sequence of arachin subunit of molecular weight 21,000

A subunit of molecular weight 21,000 from arachin, the major peanut protein, was isolated in pure form and primary structure was determined. The subunit was fragmented with CNBr, trypsin, and NBS; the fragments were separated and isolated by PAGE, gel filtration, Dowex treatment, and paper electrophoresis, and Edman degradation on each fragment, including the intact subunit, was performed. The PTH-amino acids thus obtained were identified by UV spectroscopy and TLC. The complete sequence of 176 residues was established by overlapping technique.     

In vivo genetic variability of the human immunodeficiency virus type 2 V3 region.

The principal neutralizing epitope of the human immunodeficiency virus type 1 (HIV-1) lies between two invariant cysteines in the third variable region (V3) of the viral envelope (gp120), and its amino acid sequence varies among different HIV-1 isolates. HIV-2 carries an analogous amino acid sequence between two cysteines of the V3 regions, but its functional similarity with the HIV-1 principal neutralizing epitope is uncertain. We studied the degree of genetic variation of the HIV-2 V3 region in fresh blood samples from 12 HIV-2-seropositive individuals from Guinea-Bissau. Polymerase chain reaction was used to amplify viral fragments of 465 bp containing the V3 region from cellular DNA. Nucleotide sequence analysis of the entire envelope fragment from each patient revealed that the degree of variation among field isolates of HIV-2 is comparable to that observed in the analogous region of HIV-1. Most of the HIV-2 isolates studied were highly related, suggesting the existence of a limited number of different viral strains in the cohort studied. Thus, the HIV-2 and HIV-1 V3 regions vary to a similar degree and may also have analogous functions.     

Structure and function of L-lactate dehydrogenases from thermophilic and mesophilic bacteria, IV. The primary structure of the mesophilic lactate dehydrogenase from Bacillus subtilis

The complete amino-acid sequence of lactate dehydrogenase from the mesophilic Bacillus subtilis (B. X1) was determined. Approximately 70% of the sequence was obtained by sequence analysis of intact protein (N-terminal sequence) and of four CNBr fragments (CNBr3, CNBr4, CNBr5 and CNBr6). Sequences overlapping the CNBr fragments were determined from polypeptide fragments obtained by cleavage using o-iodosobenzoic acid (cleavage at Trp) or clostripain (cleavage at Arg). The C-terminal amino-acid residue (Asn) was detected by carboxypeptidase Y-degradation. Lactate dehydrogenase from B. subtilis shows a 69% sequence homology to that from the thermophilic strain B. stearothermophilus, and a 34% sequence homology to those from higher organism. The homology of these enzymes is particularly high at the active site regions (the coenzyme and substrate binding sites). The relatively high sequence conservation of the lactate dehydrogenases from B. subtilis and B. stearothermophilus (and from other bacilli) allows a structural comparison of this temperature variants.     

Monoclonal antibody studies of creatine kinase. The ART epitope: evidence for an intermediate in protein folding.

Chemical cleavage at cysteine residues with nitrothiocyanobenzoic acid shows that the last 98 amino acids of the 380-amino-acid sequence of chick muscle creatine kinase are sufficient for binding of the monoclonal antibody CK-ART. Removal of the last 30 amino acids by cleavage at methionine residues with CNBr results in loss of CK-ART binding. CK-ART binding is also lost when these C-terminal methionine residues are oxidized to sulphoxide, but binding is regained on reduction. Proteinase K 'nicks' native CK at a single site near the C-terminus and two fragments of 327 amino acides and 53 amino acids can be separated by subsequent SDS or urea treatment. CK-ART still binds normally to 'nicked' CK, which is enzymically inactive. After treatment with either urea (in a competition enzyme-linked immunosorbent assay) or SDS (on Western blots), however, CK-ART binds to neither of the two fragments, although these treatments do not affect binding to intact CK. This suggests that parts of both CK fragments contribute to the CK-ART epitope. CK-ART is both species- and isoenzyme-specific, binding only to chick M-CK. The only C-terminal regions containing chick-specific sequences are residues 300-312 and residues 368-371, the latter group being close to the essential methionine residues. We suggest that one, or possibly both, of these regions is involved in forming the conformational epitope on the surface of the CK molecule which CK-ART recognizes. Native CK is resistant to trypsin digestion. The C-terminal half of urea-treated and partly-refolded CK is also resistant to trypsin digestion, whereas the N-terminal half is readily digested. The results suggest a C-terminal region which can refold more rapidly than the rest of the CK molecule and provide evidence for an intermediate in CK refolding.     

Primary structure of the H-2Db alloantigen

The complete amino acid sequence of the CNBr fragment comprising residues 229–284 of the murine major histocompatibility complex antigen H-2D^b has been determined using radiochemical methodology. The sequence was determined by N-terminal sequence analysis of the intact CNBr fragment and by sequence determinations of peptides derived from this fragment by trypsin and staphylococcal V8 protease cleavage. In addition to the amino acid assignments for H-2D^b, it was possible to assign the linkage position of the third N-linked glycosyl unit to the asparagine at residue 256. Additional amino acid sequence assignments have also been made for three other CNBr fragments that span residues 99–138, 139–228, and 308–331 of the H-2D^b molecule. The total protein sequence information available (222 of 338 residues) agrees in every comparable position with the protein sequence derived from the cDNA clone (pH203) isolated by Reyes and co-workers (1982b), which strongly suggests that this clone encodes H-2D^b. Combination of the protein sequence with that deduced from the cDNA clone provides the complete H-2D^b protein sequence. Comparison of this sequence with other available protein sequence information for murine class I molecules has revealed protein sequences that may be unique to either K or D region molecules.Abbreviations used in this paper HPLC high performance liquid chromatography - V8 Staphylococcus aureus V8 protease - MHC major histocompatibility complex     

Sequence polymorphisms in ribosomal RNA genes and variations in chromosomal loci of Oenothera odorata and O. laciniata

Numerous studies on Oenothera species have been investigated for the physiological and ecological characteristics. However, no such an information based on molecular cytogenetic has yet been introduced, in turn, is very essential for identifying sequence polymorphisms of rRNA genes with their loci on mitotic phases for further biological researches. In this study, sequence variations of rRNA genes in Oenothera odorata and O. laciniata were examined to identify informative factors as unique or repeat sequences in intra- and inter-specific variations. Intra-specific variation revealed that the sequences of the rRNA genes including the spacer regions were highly conserved revealing only a few variations. From the inter-specific variation, spacer regions of species were completely different as (1) non-homologous sequences in NTS and (2) different type repeat sequences in ITS 1, 2 and 5.8S rRNA, whereas the remaining coding regions were highly conserved. FISH was carried out on mitotic phases using the 5S rDNA of the analyzed sequences. From the interphase and metaphase chromosomes of the examined species, two loci of 5S rDNA in O. odorata and four loci in O. laciniata were confirmed on the telomeric region of the short arm. Due to the small size and unclear centromere of the chromosomes, karyotype could not be completed. However, we confirmed that the chromosomes are organized by meta- and acrocentric chromosomes and the chromosomes with identified loci were assumed to be paired by the location of loci at the telomeric region on the short arm with relative lengths.     

Conserved tissue-restricted expression of HUC 1-1 actin phenotype among eumetazoan organisms.

Actin has evolved from a single protein into a family of more than six distinct isoforms in mammals. Based on amino acid sequence data, actins segregate into two major classes, the "cytoplasmic" or nonmuscle actins, present in all animals, and the "a-" or muscle actins, a group restricted to vertebrate muscle. We have recently identified two unique actin isoforms in rat intestinal brush border which combine features of these two classes. The amino terminal regions of these actins indicate that they are of a cytoplasmic type and yet the carboxy terminal regions contain an epitope (defined by Mab HUC 1-1) which, among mammalian actins, is restricted to the muscle isoforms. We report here that in addition to the rat, all species thus far examined which have an intestinal "brush border" express actins containing the HUC 1-1 epitope in this region. Furthermore, we show that the actins present in the muscle tissue of nonvertebrate eumetazoans, which are all of the cytoplasmic type, also contain this epitope. Thus these findings suggest that the HUC 1-1 epitope appeared early on a subset of cytoplasmic-type actins and was retained among actins expressed in muscle tissue throughout the evolutionary divergence of these cytoplasmic-type actins to the "a-" muscle actins.     

Amino-acid sequence of human and bovine brain myelin proteolipid protein (lipophilin) is completely conserved

Proteolipid protein (PLP) was isolated from white matter of human brain by chloroform/methanol extraction and further purified by chromatography. Performic acid oxidation yielded a product homogeneous in NaDodSO4-polyacrylamide electrophoresis with a molecular mass of 30 kDa. The carboxymethylated PLP was chemically cleaved with cyanogen bromide into four fragments: CNBr I 22-24 kDa, CNBr II 5 kDa, CNBr III 1.4 kDa and CNBr IV 0.7 kDa. HBr/dimethylsulfoxide cleavage at tryptophan residues released four fragments: Trp I 14-16 kDa, Trp II 2.0 kDa, Trp III 5 kDa and Trp IV 7 kDa. Hydrophilic fragments were enriched in 50% formic acid (CNBr II, III, IV and Trp II and III), whereas hydrophobic peptides precipitated from this solvent were CNBr I, Trp I and IV. The fragments were separated by gel filtration with 90% formic acid as solvent and finally purified by gel permeation HPLC (Si 60 and Si 100) for automated liquid and solid-phase Edman degradation. Large fragments were further cleaved with different proteinases (trypsin, V8-proteinase, endoproteinase Lys-C and thermolysin). We used an improved strategy in the sequencing of the human proteolipid protein compared with our approach to the structural elucidation of bovine brain PLP. The amino-acid sequence of human PLP contains 276 residues, the same as found in bovine proteolipid protein. The two sequences proved to be identical. The possible importance of the conservative structure of this integral membrane protein is discussed.     

Spontaneous missense mutation of an immunoglobulin in a mouse myeloma cell line.

The characterisation of the alteration in amino acid sequence of the immuno globulin heavy chain of IF4, a charge mutant of the myeloma line MOPC 21, is described. This was achieved by comparing the sequence of mutant IF4 heavy chain with the known sequence of the wild type. The peptic fragment (Fab′)₂ from whole immunoglobulin, and all the ten CNBr fragments of MOPC 21 wild-type and mutant IF4 heavy chains, were identified and characterised. The only difference was in a tryptic peptide of the C-terminal CNBr fragment which had the same amino acid composition, but different electrophoretic mobilities. Thermolysin digestion products showed that asparagine 415 of wild-type heavy chain had been replaced by an aspartate in the mutant. Analysis of newly synthesized immunoglobulins from wild type and mutant showed the same charge difference, which did not seem therefore to result from deamidation.Fingerprints of the [³²P]mRNA of IF4 heavy chain were prepared. The T₁ ribonuclease oligonucleotide that includes the coding sequence for residue 415 in wild type was not found in mutant IF4.The mechanism is most likely a missense point mutation (A to G transition) in the MOPC 21 heavy chain structural cistron.     

Heterogeneity of keratan sulfate substituted on human chondrocytic large proteoglycans.

Newly synthesized 35S-labeled chondrocytic keratan sulfate chains were generated by chondrocytes of human chondrosarcoma cell line 105KC and were analyzed for heterogeneity of regional substitution, hydrodynamic size, and charge density. After isolation of the high density large chondrocytic proteoglycans and sequential digestions with chondroitinase ABC, L-1-tosylamido-2-phenylethyl chloromethyl ketone-treated trypsin, and alpha-chymotrypsin, followed by Superose 6 chromatography, two populations of keratan sulfate-containing proteoglycan fragments were identified and pooled separately. Keratan sulfate chains from each of the regions were compared after release by Pronase digestion, and differences in substitution patterns were observed; keratan sulfate chains of greater polydispersity, as well as a population of larger hydrodynamic size, were present in only one of the two regions. Alkaline/borohydride treatment confirmed both the existence of a population of uniquely large keratan sulfate chains and its restriction to a single region of proteoglycan fragments. In addition to heterogeneity of hydrodynamic size, the keratan sulfate chains exhibited regional heterogeneity of charge density and hence, of sulfation patterns. Analysis by Mono Q chromatography identified distinct groups of keratan sulfate that segregated by charge density and whose proportionate composition differed between the proteoglycan regions. Furthermore, the most highly charged species were unique to a single region and encompassed the chains of larger hydrodynamic size. This suggests that there may be regional heterogeneity of keratan sulfate chains substituted along a single class of proteoglycans and identifies a novel population of large, highly sulfated chondrocytic keratan sulfate chains.     

Evolutionarily conserved sequences of striated muscle myosin heavy chain isoforms. Epitope mapping by cDNA expression

A cDNA expression strategy was used to localize amino acid sequences which were specific for fast, as opposed to slow, isoforms of the chicken skeletal muscle myosin heavy chain (MHC) and which were conserved in vertebrate evolution. Five monoclonal antibodies (mAbs), termed F18, F27, F30, F47, and F59, were prepared that reacted with all of the known chicken fast MHC isoforms but did not react with any of the known chicken slow nor with smooth muscle MHC isoforms. The epitopes recognized by mAbs F18, F30, F47, and F59 were on the globular head fragment of the MHC, whereas the epitope recognized by mAb F27 was on the helical tail or rod fragment. Reactivity of all five mAbs also was confined to fast MHCs in the rat, with the exception of mAb F59, which also reacted with the beta-cardiac MHC, the single slow MHC isoform common to both the rat heart and skeletal muscle. None of the five epitopes was expressed on amphioxus, nematode, or Dictyostelium MHC. The F27 and F59 epitopes were found on shark, electric ray, goldfish, newt, frog, turtle, chicken, quail, rabbit, and rat MHCs. The epitopes recognized by these mAbs were conserved, therefore, to varying degrees through vertebrate evolution and differed in sequence from homologous regions of a number of invertebrate MHCs and myosin-like proteins. The sequence of those epitopes on the head were mapped using a two-part cDNA expression strategy. First, Bal31 exonuclease digestion was used to rapidly generate fragments of a chicken embryonic fast MHC cDNA that were progressively deleted from the 3' end. These cDNA fragments were expressed as beta-galactosidase/MHC fusion proteins using the pUR290 vector; the fusion proteins were tested by immunoblotting for reactivity with the mAbs; and the approximate locations of the epitopes were determined from the sizes of the cDNA fragments that encoded a particular epitope. The epitopes were then precisely mapped by expression of overlapping cDNA fragments of known sequence that covered the approximate location of the epitopes. With this method, the epitope recognized by mAb F59 was mapped to amino acids 211-231 of the chicken embryonic fast MHC and the three distinct epitopes recognized by mAbs F18, F30, and F47 were mapped to amino acids approximately 65-92. Each of these epitope sequences is at or near the ATPase active site.     

Primary structure of the hemoglobin α-chain of rose-ringed parakeet (Psittacula krameri)

The structure of the hernoglobin α-chain of Rose-ringed Parakeet was determined by sequence degradations of the intact subunit, the CNBr fragments, and peptides obtained by digestion with staphylococcal Glu-specific protease and trypsin. Using this analysis, the complete α-chain structure of 21 avian species is known, permitting comparisons of the protein structure and of avian relationships. The structure exhibits differences from previously established avian α-chains at a total of 61 positions, five of which have residues unique to those of the parakeet (Ser-12, Gly-65, Ser-67, Ala-121, and Leu-134). The analysis defines hemoglobin variation within an additional avian order (Psittaciformes), demonstrates distant patterns for evaluation of relationships within other avian orders, and lends support to taxonomic conclusions from molecular data.     

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.