Conserved features of Y RNAs: a comparison of experimentally derived secondary structures

In this study, phylogenetically conserved structural features of the Ro RNP associated Y RNAs were investigated. The human, iguana, and frog Y3 and Y4 RNA sequences have been determined previously and the respective RNAs were subjected to enzymatic and chemical probing to obtain structural information. For all of the analyzed RNAs, the probing data were used to compose secondary structures, which partly deviate from previously predicted structures. Our results confirm the existence of two stem structures, which are also found at similar positions in hY1 and hY5 RNA. For the remaining parts of hY3 and hY4 RNA the secondary structures differ from those previously proposed based upon computer predictions. What might be more important is that certain parts of the RNAs appear to be flexible, i.e., to adopt several conformations. Another striking feature is that a characteristic pyrimidine-rich region, present in every Y RNA known, is single-stranded in all secondary structures. This may suggest that this region is readily available for base pairing interactions with other cellular nucleic acids, which might be important for the as yet unknown function of the RNAs.     

Molecular evolution of 5S RNA

Summary Based on the comparative analyses of the primary structure of 5S RNAs from 19 organisms, a secondary structure model of 5S RNA is proposed. 5S RNA has essentially the same structure among all prokaryotic species. The same is true for eukaryotic 5S RNAs. Prokaryotic and eukaryotic 5S RNAs are also quite similar to each other, except for a difference in a specific region.By comparing the nucleotide alignment from the juxtaposed 5S RNA secondary structures, a phylogenic tree of nineteen organisms was constructed. The time of divergence between prokaryotes and eukaryotes was estimated to be 2.5×10⁹ years ago (minimum estimate: 2.1×10⁹).     

Estimating the Contributions of Selection and Self-Organization in RNA Secondary Structure

In addition to characteristic structural properties imposed by evolutionary modification, evolved, single-stranded RNAs also display characteristic structural properties imposed by intrinsic physical constraints on RNA polymer folding. The balance of intrinsic and functionally selected characters in the folded conformation of evolved secondary structures was determined by comparing the predicted secondary structures of evolved and unevolved (random) RNA sequences. Though evolved conformations are significantly more ordered than conformations of random-sequence RNA, this analysis demonstrates that the majority of conformational order within evolved structures results not from evolutionary optimization but from constraints imposed by rules intrinsic to RNA polymer folding. Received: 25 November 1998 / Accepted: 12 February 1999     

Nucleotide sequence of a crustacean 18S ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs

The primary structure of the gene for 18 S rRNA of the crustacean Artemia salina was determined. The sequence has been aligned with 13 other small ribosomal subunit RNA sequences of eukaryotic, archaebacterial, eubacterial, chloroplastic and plant mitochondrial origin. Secondary structure models for these RNAs were derived on the basis of previously proposed models and additional comparative evidence found in the alignment. Although there is a general similarity in the secondary structure models for eukaryotes and prokaryotes, the evidence seems to indicate a different topology in a central area of the structures.     

Structural analyses of EBER1 and EBER2 ribonucleoprotein particles present in Epstein-Barr virus-infected cells.

The ribonucleoprotein (RNP) particles containing the Epstein-Barr virus-associated small RNAs EBER1 and EBER2 were analyzed to determine their RNA secondary structures and sites of RNA-protein interaction. The secondary structures were probed with nucleases and by chemical modification with single-strand-specific reagents, and the sites of modification or cleavage were mapped by primer extension. These data were used to develop secondary structures for the two RNAs, and likely sites of close RNA-protein contact were identified by comparing modification patterns for naked RNA and RNA in RNP particles. In addition, sites of interaction between each Epstein-Barr virus-encoded RNA (EBER) and the La antigen were identified by analyzing RNA fragments resistant to digestion by RNase A or T1 after immunoprecipitation by an anti-La serum sample from a lupus patient. Our results confirm earlier findings that the La protein binds to the 3' terminus of each molecule. Possible functions for the EBER RNPs are discussed.     

Diverse self-association properties within a family of phage packaging RNAs

The packaging RNA (pRNA) found in phi29 bacteriophage is an essential component of a molecular motor that packages the phage''s DNA genome. The pRNA forms higher-order multimers by intermolecular “kissing” interactions between identical molecules. The phi29 pRNA is a proven building block for nanotechnology and a model to explore the rare phenomenon of naturally occurring RNA self-association. Although the self-association properties of the phi29 pRNA have been extensively studied and this pRNA is used in nanotechnology, the characteristics of phylogenetically related pRNAs with divergent sequences are comparatively underexplored. These diverse pRNAs may lend new insight into both the rules governing RNA self-association and for RNA engineering. Therefore, we used a combination of biochemical and biophysical methods to resolve ambiguities in the proposed secondary structures of pRNAs from M2, GA1, SF5, and B103 phage, and to discover that different naturally occurring pRNAs form multimers of different stoichiometry and thermostability. Indeed, the M2 pRNA formed multimers that were particularly thermostable and may be more useful than phi29 pRNA for many applications. To determine if diverse pRNA behaviors are conferred by different kissing loop sequences, we designed and tested chimeric RNAs based on our revised secondary structural models. We found that although the kissing loops are essential for self-association, the critical determinant of multimer stability and stoichiometry is likely the diverse three-way junctions found in these RNAs. Using known features of RNA three-way junctions and solved structures of phi29 pRNA''s junction, we propose a model for how different junctions affect self-association.     

Predicting common foldings of homologous RNAs.

A new approach is proposed for determining common RNA secondary structures within a set of homologous RNAs. The approach is a combination of phylogenetic and thermodynamic methods which is based on the prediction of optimal and suboptimal secondary structures, topological similarity searches and phylogenetic comparative analysis. The optimal and suboptimal RNA secondary structures are predicted by energy minimization. Structural comparison of the predicted RNA secondary structures is used to find conserved structures that are topologically similar in all these homologous RNAs. The validity of the conserved structural elements found is then checked by phylogenetic comparison of the sequences. This procedure is used to predict common structures of ribonuclease P (RNAase P) RNAs.     

RNA secondary structure modeling at consistent high accuracy using differential SHAPE

RNA secondary structure modeling is a challenging problem, and recent successes have raised the standards for accuracy, consistency, and tractability. Large increases in accuracy have been achieved by including data on reactivity toward chemical probes: Incorporation of 1M7 SHAPE reactivity data into an mfold-class algorithm results in median accuracies for base pair prediction that exceed 90%. However, a few RNA structures are modeled with significantly lower accuracy. Here, we show that incorporating differential reactivities from the NMIA and 1M6 reagents—which detect noncanonical and tertiary interactions—into prediction algorithms results in highly accurate secondary structure models for RNAs that were previously shown to be difficult to model. For these RNAs, 93% of accepted canonical base pairs were recovered in SHAPE-directed models. Discrepancies between accepted and modeled structures were small and appear to reflect genuine structural differences. Three-reagent SHAPE-directed modeling scales concisely to structurally complex RNAs to resolve the in-solution secondary structure analysis problem for many classes of RNA.     

Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites

Virusoids are circular single-stranded RNAs dependent on plant viruses for replication and encapsidation. Virusoid replication appears to involve longer-than-unit-length plus and minus RNAs, indicating that unit-length plus RNA is generated by specific cleavage reactions. Here, we synthesize plus and minus partial-length RNAs of the 324-nucleotide virusoid from lucerne transient streak virus in vitro. Both RNAs self-cleave at a unique site in the presence of magnesium ions to give 5' hydroxyl and 2',3' cyclic phosphodiester termini. Conformations other than the native structures are necessary for cleavage. Similar secondary structures with considerable sequence homology are proposed for the active sites of these and other plant pathogenic RNAs. Our results are consistent with certain rolling-circle replication models.     

Stiffness of viroids and viroid-like RNA in solution.

The sedimentation coefficients of the potato spindle tuber viroid, four viroid-like RNAs from cadang-cadang-disease, circular RNA from velvet tobacco mottle virus, circular RNA from Solanum nodiflorum mottle virus and double stranded RNA5 from cucumber mosaic virus were measured in the analytical ultracentrifuge. The numbers of nucleotides of the RNA species varied between 246 and 670. The hydrodynamic models of rigid rods and flexible cylinders were applied for the interpretation of the sedimentation coefficients. Double-stranded RNA5 from cucumber mosaic virus with 335 basepairs fits the model of a rigid rod with an hydrated diameter of 29 A. Potato spindle tuber viroid and the four viroid-like RNA species of cadang-cadang-disease form a homologous series of flexible cylinders with a Kuhn's statistical length lambda-1 of 600 A. The circular RNA from the two viruses mentioned above are more flexibel than the viroids and viroid-like RNAs. The hydrodynamic interpretation is in accordance with thermodynamic data and secondary structure models. In two of the RNAs from cadang-cadang, cruciform structures would also be possible on the basis of the nucleotide sequence. The hydrodynamic data, however, favour clearly the extended structure over the cruciform.     

Evolutionary relationships amongst archaebacteria. A comparative study of 23 S ribosomal RNAs of a sulphur-dependent extreme thermophile, an extreme halophile and a thermophilic methanogen

The 23 S RNA genes representative of each of the main archaebacterial subkingdoms, Desulfurococcus mobilis an extreme thermophile, Halococcus morrhuae an extreme halophile and Methanobacterium thermoautotrophicum a thermophilic methanogen, were cloned and sequenced. The inferred RNA sequences were aligned with all the available 23 S-like RNAs of other archaebacteria, eubacteria/chloroplasts and the cytoplasm of eukaryotes. Universal secondary structural models containing six major structural domains were refined, and extended, using the sequence comparison approach. Much of the present structure was confirmed but six new helices were added, including one that also exists in the eukaryotic 5.8 S RNA, and extensions were made to several existing helices. The data throw doubt on whether the 5' and 3' ends of the 23 S RNA interact, since no stable helix can form in either the extreme thermophile or the methanogen RNA. A few secondary structural features, specific to the archaebacterial RNAs were identified; two of these were supported by a comparison of the archaebacterial RNA sequences, and experimentally, using chemical and ribonuclease probes. Seven tertiary structural interactions, common to all 23 S-like RNAs, were predicted within unpaired regions of the secondary structural model on the basis of co-variation of nucleotide pairs; two lie in the region of the 23 S RNA corresponding to 5.8 S RNA but they are not conserved in the latter. The flanking sequences of each of the RNAs could base-pair to form long RNA processing stems. They were not conserved in sequence but each exhibited a secondary structural feature that is common to all the archaebacterial stems for both 16 S and 23 S RNAs and constitutes a processing site. Kingdom-specific nucleotides have been identified that are associated with antibiotic binding sites at functional centres in 23 S-like RNAs: in the peptidyl transferase centre (erythromycin-domain V) the archaebacterial RNAs classify with the eukaryotic RNAs; at the elongation factor-dependent GTPase centre (thiostrepton-domain II) they fall with the eubacteria, and at the putative amino acyl tRNA site (alpha-sarcin-domain VI) they resemble eukaryotes. Two of the proposed tertiary interactions offer a structural explanation for how functional coupling of domains II and V occurs at the peptidyl transferase centre. Phylogenetic trees were constructed for the archaebacterial kingdom, and for the other two kingdoms, on the basis of the aligned 23 S-like RNA sequences.(ABSTRACT TRUNCATED AT 400 WORDS)     

Secondary structure alone is generally not statistically significant for the detection of noncoding RNAs

MOTIVATION: Several results in the literature suggest that biologically interesting RNAs have secondary structures that are more stable than expected by chance. Based on these observations, we developed a scanning algorithm for detecting noncoding RNA genes in genome sequences, using a fully probabilistic version of the Zuker minimum-energy folding algorithm. RESULTS: Preliminary results were encouraging, but certain anomalies led us to do a carefully controlled investigation of this class of methods. Ultimately, our results argue that for the probabilistic model there is indeed a statistical effect, but it comes mostly from local base-composition bias and not from RNA secondary structure. For the thermodynamic implementation (which evaluates statistical significance by doing Monte Carlo shuffling in fixed-length sequence windows, thus eliminating the base-composition effect) the signals for noncoding RNAs are still usually indistinguishable from noise, especially when certain statistical artifacts resulting from local base-composition inhomogeneity are taken into account. We conclude that although a distinct, stable secondary structure is undoubtedly important in most noncoding RNAs, the stability of most noncoding RNA secondary structures is not sufficiently different from the predicted stability of a random sequence to be useful as a general genefinding approach.     

Isoenergetic microarrays to study the structure and interactions of DsrA and OxyS RNAs in two- and three-component complexes

Information on the secondary structure and interactions of RNA is important to understand the biological function of RNA as well as in applying RNA as a tool for therapeutic purposes. Recently, the isoenergetic microarray mapping method was developed to improve the prediction of RNA secondary structure. Herein, for the first time, isoenergetic microarrays were used to study the binding of RNA to protein or other RNAs as well as the interactions of two different RNAs and protein in a three-component complex. The RNAs used as models were the regulatory DsrA and OxyS RNAs from Escherichia coli, the fragments of their target mRNAs (fhlA and rpoS), and their complexes with Hfq protein. The collected results showed the advantages and some limitations of microarray mapping.     

FebRNA: An automated fragment-ensemble-based model for building RNA 3D structures

Knowledge of RNA three-dimensional (3D) structures is critical to understanding the important biological functions of RNAs. Although various structure prediction models have been developed, the high-accuracy predictions of RNA 3D structures are still limited to the RNAs with short lengths or with simple topology. In this work, we proposed a new model, namely FebRNA, for building RNA 3D structures through fragment assembly based on coarse-grained (CG) fragment ensembles. Specifically, FebRNA is composed of four processes: establishing the library of different types of non-redundant CG fragment ensembles regardless of the sequences, building CG 3D structure ensemble through fragment assembly, identifying top-scored CG structures through a specific CG scoring function, and rebuilding the all-atom structures from the top-scored CG ones. Extensive examination against different types of RNA structures indicates that FebRNA consistently gives the reliable predictions on RNA 3D structures, including pseudoknots, three-way junctions, four-way and five-way junctions, and RNAs in the RNA-Puzzles. FebRNA is available on the Web site: https://github.com/Tan-group/FebRNA.     

SCARNA: fast and accurate structural alignment of RNA sequences by matching fixed-length stem fragments

MOTIVATION: The functions of non-coding RNAs are strongly related to their secondary structures, but it is known that a secondary structure prediction of a single sequence is not reliable. Therefore, we have to collect similar RNA sequences with a common secondary structure for the analyses of a new non-coding RNA without knowing the exact secondary structure itself. Therefore, the sequence comparison in searching similar RNAs should consider not only their sequence similarities but also their potential secondary structures. Sankoff's algorithm predicts the common secondary structures of the sequences, but it is computationally too expensive to apply to large-scale analyses. Because we often want to compare a large number of cDNA sequences or to search similar RNAs in the whole genome sequences, much faster algorithms are required. RESULTS: We propose a new method of comparing RNA sequences based on the structural alignments of the fixed-length fragments of the stem candidates. The implemented software, SCARNA (Stem Candidate Aligner for RNAs), is fast enough to apply to the long sequences in the large-scale analyses. The accuracy of the alignments is better or comparable with the much slower existing algorithms. AVAILABILITY: The web server of SCARNA with graphical structural alignment viewer is available at http://www.scarna.org/.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

STAR3D: a stack-based RNA 3D structural alignment tool

The various roles of versatile non-coding RNAs typically require the attainment of complex high-order structures. Therefore, comparing the 3D structures of RNA molecules can yield in-depth understanding of their functional conservation and evolutionary history. Recently, many powerful tools have been developed to align RNA 3D structures. Although some methods rely on both backbone conformations and base pairing interactions, none of them consider the entire hierarchical formation of the RNA secondary structure. One of the major issues is that directly applying the algorithms of matching 2D structures to the 3D coordinates is particularly time-consuming. In this article, we propose a novel RNA 3D structural alignment tool, STAR3D, to take into full account the 2D relations between stacks without the complicated comparison of secondary structures. First, the 3D conserved stacks in the inputs are identified and then combined into a tree-like consensus. Afterward, the loop regions are compared one-to-one in accordance with their relative positions in the consensus tree. The experimental results show that the prediction of STAR3D is more accurate for both non-homologous and homologous RNAs than other state-of-the-art tools with shorter running time.     

Modelling the secondary structures of slippage-prone hypervariable RNA regions: the example of the tiger beetle 18S rRNA variable region V4.

Variable regions within ribosomal RNAs frequently vary in length as a result of incorporating products of slippage. This makes constructing secondary structure models problematic because base homology is difficult or impossible to establish between species. Here, we model such a region by comparing the results of the MFOLD suboptimal folding algorithm for different species to identify conserved structures. Based on the reconstruction of base change on a phylogenetic tree of the species and comparison against null models of character change, we devise a statistical analysis to assess support of these structures from compensatory and semi-compensatory (i.e. G.C to G.U or A.U to G.U) mutations. As a model system we have used variable region V4 from cicindelid (tiger beetle) small subunit ribosomal RNAs (SSU rRNAs). This consists of a mixture of conserved and highly variable subregions and has been subject to extensive comparative analysis in the past. The model that results is similar to a previously described model of this variable region derived from a different set of species and contains a novel structure in the central, highly variable part. The method we describe may be useful in modelling other RNA regions that are subject to slippage.     

Three-dimensional models of the tRNA-like 3' termini of some plant viral RNAs.

Various plant viral RNAs possess a 3'' terminus with tRNA-like properties. These viral RNAs are charged with an amino acid upon incubation with the cognate aminoacyl-tRNA synthetase and ATP. We have studied the structure of end-labelled 3''-terminal fragments of turnip yellow mosaic virus RNA and brome mosaic virus RNA 2 with chemical modifications of the adenosine and cytidine residues and with enzymatic digestions using RNase T1, nuclease S1 and the double-strand-specific ribonuclease from cobra venom. The data indicate that the 3'' termini of these plant viral RNAs lack a cloverleaf structure as found in classical tRNA. The three-dimensional folding, however, reveals a striking resemblance with classical tRNA. The models proposed are supported by phylogenetic data. Apparently distinct three-dimensional solutions have evolved to meet the requirements for faithful recognition by tRNA-specific enzymes. The way in which the aminoacyl acceptor arms of these tRNA-like structures are constructed reveal novel features in RNA folding which may have a bearing on the secondary and tertiary structures of RNA in general. The dynamic behaviour of brome mosaic virus RNA 2 in solution presumably is illustrative of conformational transitions, which RNAs generally undergo on changing the ionic conditions.