Surface areas of 1-palmitoyl phosphatidylcholines and their interactions with cholesterol.

The activity of the high-molecular-weight beta-glucosidase (beta-D-glucoside glucohydrolase, EC 3.2.1.21) obtained from culture filtrates of Botryodiplodia theobromae Pat. was affected by added NaCl in such a way that an initial phase of stimulation was followed by a phase of rapid non-linear decrease in velocity and finally by a phase of slow linear decrease in velocity as the concentration of NaCl was increased. In the presence of 0.014 M-sodium acetate/acetic acid buffer (pH 5.0) there was a slight increase in enzymic activity in the presence of low concentrations of dioxan (up to about 10% dioxan) and a rapid decrease in enzymic activity at higher dioxan concentrations, but both effects were mitigated in the presence of 0.1 M buffer. The order of efficiency of added glucosyl acceptors in beta-glucosidase-catalysed reactions was found to be fructose greater than sucrose greater than glycerol greater than methanol. The enzyme was inactivated by the active-site-directed compound conduritol-B-epoxide; but this inactivation was concentration-dependent, was prevented by 10 mM-glucose, and involved an acidic group with pKa 4.3. A rate equation has been derived on the assumption of a mechanism of action involving a solvent-separated and an intimate glucosyl cation-carboxylate ion-pair intermediate and an alpha-glucosyl enzyme intermediate [Umezurike, G. M. (1981) Biochem. J. 199, 203-209]. Calculations based on the application of the derived rate equation and the calculated kinetic parameters show that the rate equation explains the peculiar properties of beta-glucosidase in the presence of added glucosyl acceptors or of NaCl.     

Stabilization of Z-RNA by chemical bromination and its recognition by anti-Z-DNA antibodies

Limited chemical bromination of poly[r(C-G)] (32% br8G, 26% br5C) results in partial modification of guanine C8 and cytosine C5, producing a mixture of A- and Z-RNA forms. The Z conformation in the brominated polynucleotide is stabilized at much lower ionic strength than in the unmodified polynucleotide. More extensive bromination of poly[r(C-G)] (greater than 49% br8G, 43% br5C) results in stabilization of a form of RNA having a Z-DNA-like (ZD) CD spectrum in low-salt, pH 7.0-7.5 buffers. Raising the ionic strength to 6 M NaBr or NaClO4 results in a transition in Br-poly[r(C-G)] to a Z-RNA (ZR) conformation as judged by CD spectroscopy. At lower ionic strength Z-DNA-like (ZD) and A-RNA conformations are also present. 1H NMR data demonstrate a 1/1 mixture of A- and Z-RNAs in 110 mM NaBr buffer at 37 degrees C. Nuclear Overhauser effect (NOE) experiments permit complete assignments of GH8, CH6, CH5, GH1', and CH1' resonances in both the A- and Z-forms. GH8----GH1' NOEs demonstrate the presence of both A- and Z-form GH8 resonances in slow exchange on the NMR time scale. The NMR results indicate that unbrominated guanine residues undergo transition to the syn conformation (Z-form). Raman scattering data are consistent with a mixture of A- and Z-RNAs in 110 mM NaCl buffer at 37 degrees C. Comparison with the spectrum of Z-DNA indicates that there may be different glycosidic torsion angles in Z-RNA and Z-DNA [Tinoco, I., Jr., Cruz, P., Davis, P., Hall, K., Hardin, C. C., Mathies, R. A., Puglisi, J. D., Trulson, M. O., Johnson, W. C., & Neilson, T. (1986) in Structure and Dynamics of RNA, pp 55-68, Plenum, New York].(ABSTRACT TRUNCATED AT 250 WORDS)     

Effects of nucleotide bromination on the stabilities of Z-RNA and Z-DNA: a molecular mechanics/thermodynamic perturbation study

The structures of ZI- and ZII-form RNA and DNA oligonucleotides were energy minimized in vacuum using the AMBER molecular mechanics force field. Alternating C-G sequences were studied containing either unmodified nucleotides, 8-bromoguanosine in place of all guanosine residues, 5-bromocytidine in place of all cytidine residues, or all modified residues. Some molecules were also energy minimized in the presence of H2O and cations. Free energy perturbation calculations were done in which G8 and C5 hydrogen atoms in one or two residues of Z-form RNAs and DNAs were replaced in a stepwise manner by bromines. Bromination had little effect on the structures of the energy-minimized molecules. Both the minimized molecular energies and the results of the perturbation calculations indicate that bromination of guanosine at C8 will stabilize the Z forms of RNA and DNA relative to the nonbrominated Z form, while bromination of cytidine at C5 stabilizes Z-DNA and destabilizes Z-RNA. These results are in agreement with experimental data. The destabilizing effect of br5C in Z-RNAs is apparently due to an unfavorable interaction between the negatively charged C5 bromine atom and the guanosine hydroxyl group. The vacuum-minimized energies of the ZII-form oligonucleotides are lower than those of the corresponding ZI-form molecules for both RNA and DNA. Previous x-ray diffraction, nmr, and molecular mechanics studies indicate that hydration effects may favor the ZI conformation over the ZII form in DNA. Molecular mechanics calculations show that the ZII-ZI energy differences for the RNAs are greater than three times those obtained for the DNAs. This is due to structurally reinforcing hydrogen-bonding interactions involving the hydroxyl groups in the ZII form, especially between the guanosine hydroxyl hydrogen atom and the 3'-adjacent phosphate oxygen. In addition, the cytidine hydroxyl oxygen forms a hydrogen bond with the 5'-adjacent guanosine amino group in the ZII-form molecule. Both of these interactions are less likely in the ZI-form molecule: the former due to the orientation of the GpC phosphate away from the guanosine ribose in the ZI form, and the latter apparently due to competitive hydrogen bonding of the cytidine 2'-hydroxyl hydrogen with the cytosine carbonyl oxygen in the ZI form. The hydrogen-bonding interaction between the cytidine hydroxyl oxygen and the 5'-adjacent guanosine amino group in Z-RNA twists the amino group out of the plane of the base. This may be responsible for differences in the CD and Raman spectra of Z-RNA and Z-DNA.     

A dynamic programming algorithm for finding alternative RNA secondary structures.

Dynamic programming algorithms that predict RNA secondary structure by minimizing the free energy have had one important limitation. They were able to predict only one optimal structure. Given the uncertainties of the thermodynamic data and the effects of proteins and other environmental factors on structure, the optimal structure predicted by these methods may not have biological significance. We present a dynamic programming algorithm that can determine optimal and suboptimal secondary structures for an RNA. The power and utility of the method is demonstrated in the folding of the intervening sequence of the rRNA of Tetrahymena. By first identifying the major secondary structures corresponding to the lowest free energy minima, a secondary structure of possible biological significance is derived.     

Minor nucleosides in RNA: optical studies of dinucleoside phosphates containing inosine

From the study of circular dichroism (CD) spectra and hypochromism we conclude that the dinucleoside phosphates IpA, ApI, and IpI stack, while IpU stacks very little. Studies with various concentrations of IpI in low salt, and 1M NaCl indicate that the stacking geometry of this compound is sensitive to the ionic strength of solution. The CD of poly I is presented and compared to the data for IpI. Little change was found in the CD of poly (G,I) (1 : 1) with change of salt concentration, and we conclude that, unlike Poly I, there is no major structural change. From the CD of poly (G, I), IpI, and GpG, the CD of IpG plus GpI is calculated by using the nearest-neighbor approximation. From the calculated spectrum, we tentatively conclude that there is stacking in either IpG or GpI or both.     

Minor nucleosides in RNA: Optical studies of dinucleoside phosphates containing dihydrouridine

Photoreduction with NaBH₄ was used to reduce the dinucleoside phosphates ApU, UpA, and GpU to the corresponding molecules containing dihydrouridine (H). Also obtained from this reaction are dinucleoside phosphates containing (β-N-ribosyl) ureido-propanol, an open ring form of dihydrouridine. The results of CD and ultraviolet absorption studies with these compounds imply that HpA is strongly stacked, but that ApH and GpH are only slightly stacked. The temperature dependence of the CD suggests that the stacking in HpA is unusual. The results with compounds containing open ring forms of dihydrouridine indicate that there is more intramolecular interaction when the ring is open than when it is closed.     

Calculated optical properties of 64 trinucleoside diphosphates

The optical rotatory dispersion and ultraviolet absorption spectra of the 64 trinucleoside diphosphates containing the bases A, U, C, and G have been calculated by using a simple semiempirical approach. These calculations accurately predict the optical properties of the nine trimers for which extensive experimental results are available. The computed optical data should be useful in the identification of oligonucleotides obtained in the course of sequence determination of ribonucleic acids and should simplify the determination of the concentration of oligonucleotides in aqueous solution. Additional calculations indicate that it should be possible to analyze most, mixtures of sequence isomers of trinucleoside diphosphates by direct, measurement of the ORD of the mixture at neutral pH.     

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.     

A base-triple structural domain in RNA.

An oligonucleotide modeled on a proposed base-triple domain of the Tetrahymena group I intron has been characterized by NMR. The oligonucleotide contains two double-helix regions with adjacent single-stranded nucleotides. The NMR data show that the two helices stack coaxially, although the rotation between the two helices is approximately twice as large as the rotation between normal base pairs. The rotation between the two helices allows the single-stranded nucleotides to form U.U.G and A.G.C base triples in the minor groove. The A.G.C base triple contains a hydrogen bond between the adenine N1 and a 2'-hydroxyl in the minor groove of the G.C pair. A similar hydrogen bond between an adenine and a 2'-hydroxyl in transfer RNA suggests that this could be a recurring tertiary interaction in RNA.