Structural re-positioning,in silico molecular modelling,oxidative degradation,and biological screening of linagliptin as adenosine 3 receptor (ADORA3) modulators targeting hepatocellular carcinoma

Chemical entities with structural diversity were introduced as candidates targeting adenosine receptor with different clinical activities, containing 3,7-dihydro-1H-purine-2,6-dione, especially adenosine 3 receptors (ADORA3). Our initial approach started with pharmacophore screening of ADORA3 modulators; to choose linagliptin (LIN), approved anti-diabetic drug as Dipeptidyl peptidase-4 inhibitors, to be studied for its modulating effect towards ADORA3. This was followed by generation, purification, analytical method development, and structural elucidation of oxidative degraded product (DEG). Both of LIN and DEG showed inhibitory profile against hepatocellular carcinoma cell lines with induction of apoptosis at G2/M phase with increase in caspase-3 levels, accompanied by a downregulation in gene and protein expression levels of ADORA3 with a subsequent increase in cAMP. Quantitative in vitro assessment of LIN binding affinity against ADORA3 was also performed to exhibit inhibitory profile at Ki of 37.7?nM. In silico molecular modelling showing binding affinity of LIN and DEG towards ADORA3 was conducted.     

Enhanced decolorization of Solar brilliant red 80 textile dye by an indigenous white rot fungus Schizophyllum commune IBL-06

An indigenously isolated white rot fungus, Schizophyllum commune IBL-06 was used to decolorize Solar brilliant red 80 direct dye in Kirk’s basal salts medium. In initial screening study, the maximum decolorization (84.8%) of Solar brilliant red 80 was achieved in 7 days shaking incubation period at pH 4.5 and 30 °C. Different physical and nutritional factors including pH, temperature and fungal inoculum density were statistically optimized through Completely Randomized Design (CRD), to enhance the efficiency of S. commune IBL-06 for maximum decolorization of Solar brilliant red 80 dye. The effects of inexpensive carbon and nitrogen sources were also investigated. Percent dye decolorization was determined by a reduction in optical density at the wavelength of maximum absorbance (λ_max, 590 nm). Under optimum conditions, the S. commune IBL-06 completely decolorized (100%) the Solar brilliant red 80 dye using maltose and ammonium sulfate as inexpensive carbon and nitrogen sources, respectively in 3 days. S. commune IBL-06 produced the three major ligninolytic enzymes lignin peroxidase (LiP), manganase peroxidase (MnP) and lacaase (Lac) during the decolorization of Solar brilliant red 80. LiP was the major enzyme (944 U/mL) secreted by S. commune IBL-06 along with comparatively lower activities of MnP and Laccase.     

Galinsosides A and B,bioactive flavanone glucosides from Galinsoga parviflora

Galinsosides A (1) and B (2), new flavanone glucosides together with two known flavanones, 7,3′,4′-trihydroxyflavanone (3) and 3,5,7,3′,4′-pentahydroxyflavanone (4) have been isolated from an ethyl acetate- soluble fraction of Galinsoga parviflora. Their structures were assigned on the basis of spectral studies. Compound 1 showed significant antioxidant and urease inhibitory activity while compound 2 was moderately active. On the other hand, 2 showed inhibitory potential against α-glucosidase.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Comprehensive Genetic Dissection of the Hemocyte Immune Response in the Malaria Mosquito Anopheles gambiae

Reverse genetics in the mosquito Anopheles gambiae by RNAi mediated gene silencing has led in recent years to an advanced understanding of the mosquito immune response against infections with bacteria and malaria parasites. We developed RNAi screens in An. gambiae hemocyte-like cells using a library of double-stranded RNAs targeting 109 genes expressed highly or specifically in mosquito hemocytes to identify novel regulators of the hemocyte immune response. Assays included phagocytosis of bacterial bioparticles, expression of the antimicrobial peptide CEC1, and basal and induced expression of the mosquito complement factor LRIM1. A cell viability screen was also carried out to assess dsRNA cytotoxicity and to identify genes involved in cell growth and survival. Our results identify 22 novel immune regulators, including proteins putatively involved in phagosome assembly and maturation (Ca²⁺ channel, v-ATPase and cyclin-dependent protein kinase), pattern recognition (fibrinogen-domain lectins and Nimrod), immune modulation (peptidase and serine protease homolog), immune signaling (Eiger and LPS-induced factor), cell adhesion and communication (Laminin B1 and Ninjurin) and immune homeostasis (Lipophorin receptor). The development of robust functional cell-based assays paves the way for genome-wide functional screens to study the mosquito immune response to infections with human pathogens.     

The Diagnostic Accuracy of Urine Lipoarabinomannan Test for Tuberculosis Screening in a South African Correctional Facility

Background

We evaluated the diagnostic accuracy of the urine lipoarabinomannan (LAM) antigen detection assay (Clearview TB-ELISA) to screen for tuberculosis in a South African correctional facility.

Methods

Between September 2009 and October 2010, male offenders were screened for tuberculosis (symptoms, chest radiograph, two spot sputum specimens for microscopy and culture), and urine tested for LAM. Sensitivity, specificity and predictive values of LAM were calculated using definite and probable tuberculosis combined as our gold standard.

Findings

33/871 (3.8%) participants (26% HIV-positive) had tuberculosis. Amongst HIV-positive vs. HIV-negative offenders the sensitivity and specificity of LAM was 7.1% vs. 0% and 98.5% vs. 99.8% respectively.

Conclusion

Urine LAM ELISA has inadequate sensitivity for TB screening in this population.     

In vitro selection of DNA-cleaving deoxyribozyme with site-specific thymidine excision activity

Single-nucleotide polymorphisms, either inherited or due to spontaneous DNA damage, are associated with numerous diseases. Developing tools for site-specific nucleotide modification may one day provide a way to alter disease polymorphisms. Here, we describe the in vitro selection and characterization of a new deoxyribozyme called F-8, which catalyzes nucleotide excision specifically at thymidine. Cleavage by F-8 generates 3′- and 5′-phosphate ends recognized by DNA modifying enzymes, which repair the targeted deoxyribonucleotide while maintaining the integrity of the rest of the sequence. These results illustrate the potential of DNAzymes as tools for DNA manipulation.     

Isolation and characterization of a biosurfactant‐producing Fusarium sp. BS‐8 from oil contaminated soil

This study reports characterization of a biosurfactant‐producing fungal isolate from oil contaminated soil of Missa Keswal oil field, Pakistan. It was identified as Fusarium sp. BS‐8 on the basis of macroscopic and microscopic morphology, and 18S rDNA gene sequence homology. The biosurfactant‐producing capability of the fungal isolates was screened using oil displacement activity, emulsification index assay, and surface tension (SFT) measurement. The optimization of operational parameters and culture conditions resulted in maximum biosurfactant production using 9% (v/v) inoculum at 30°C, pH 7.0, using sucrose and yeast extract, as carbon and nitrogen sources, respectively. A C:N ratio of 0.9:0.1 (w/w) was found to be optimum for growth and biosurfactant production. At optimal conditions, it attained lowest SFT (i.e., 32 mN m^?1) with a critical micelle concentration of ≥ 1.2 mg mL^?1. During 5 L shake flask fermentation experiments, the biosurfactant productivity was 1.21 g L^?1 pure biosurfactant having significant emulsifying index (E₂₄, 70%) and oil‐displacing activity (16 mm). Thin layer chromatography and Fourier transform infrared spectrometric analyses indicated a lipopeptide type of the biosurfactant. The Fusarium sp. BS‐8 has substantial potential of biosurfactant production, yet it needs to be fully characterized with possibility of relatively new class of biosurfactants. © 2014 American Institute of Chemical Engineers Biotechnol. Prog., 30:1065–1075, 2014     

Differential expression of specific cellular defense proteins in rat hypothalamus under simulated microgravity induced conditions: Comparative proteomics

Microgravity severely halts the structural and functional cerebral capacity of astronauts especially affecting their brains due to the stress produced by cephalic fluid shift. We employed a rat tail suspension model to substantiate simulated microgravity (SM) in brain. In this study, comparative mass spectrometry was applied in order to demonstrate the differential expression of 17 specific cellular defense proteins. Gamma‐enolase, peptidyl‐prolyl cis‐trans isomerase A, glial fibrillary acidic protein, heat shock protein HSP 90‐alpha, 10 kDa heat shock protein, mitochondrial, heat shock cognate 71 kDa protein, superoxide dismutase 1 and dihydropyrimidinase‐related protein 2 were found to be upregulated by HPLC/ESI‐TOF. Furthermore, five differentially expressed proteins including 60 kDa heat shock protein, mitochondrial, heat shock protein HSP 90‐beta, peroxiredoxin‐2, stress‐induced‐phosphoprotein, and UCHL‐1 were found to be upregulated by HPLC/ESI‐Q‐TOF MS. In addition, downregulated proteins include cytochrome C, superoxide dismutase 2, somatic, and excitatory amino acid transporter 1 and protein DJ‐1. Validity of MS results was successfully performed by Western blot analysis of DJ‐1 protein. This study will not only help to understand the neurochemical responses produced under microgravity but also will give future direction to cure the proteomic losses and their after effects in astronauts.