Hesperidin Produces Cardioprotective Activity via PPAR-γ Pathway in Ischemic Heart Disease Model in Diabetic Rats

The present study investigated the effect of hesperidin, a natural flavonoid, in cardiac ischemia and reperfusion (I/R) injury in diabetic rats. Male Wistar rats with diabetes were divided into five groups and were orally administered saline once daily (IR-sham and IR-control), Hesperidin (100 mg/kg/day; IR-Hesperidin), GW9962 (PPAR-γ receptor antagonist), or combination of both for 14 days. On the 15^th day, in the IR-control and IR-treatment groups, rats were subjected to left anterior descending (LAD) coronary artery occlusion for 45 minutes followed by a one-hour reperfusion. Haemodynamic parameters were recorded and rats were sacrificed; hearts were isolated for biochemical, histopathological, ultrastructural and immunohistochemistry. In the IR-control group, significant ventricular dysfunctions were observed along with enhanced expression of pro-apoptotic protein Bax. A decline in cardiac injury markers lactate dehydrogenase activity, CK-MB and increased content of thiobarbituric acid reactive substances, a marker of lipid peroxidation, and TNF-α were observed. Hesperidin pretreatment significantly improved mean arterial pressure, reduced left ventricular end-diastolic pressure, and improved both inotropic and lusitropic function of the heart (+LVdP/dt and –LVdP/dt) as compared to IR-control. Furthermore, hesperidin treatment significantly decreased the level of thiobarbituric acid reactive substances and reversed the activity of lactate dehydrogenase towards normal value. Hesperidin showed anti-apoptotic effects by upregulating Bcl-2 protein and decreasing Bax protein expression. Additionally, histopathological and ultrastructural studies reconfirmed the protective action of hesperidin. On the other hand, GW9662, selective PPAR-γ receptor antagonist, produced opposite effects and attenuated the hesperidin induced improvements. The study for the first time evidence the involvement of PPAR-γ pathway in the cardioprotective activity of hesperidin in I/R model in rats.     

Investigation on the Fusarium induced stress protein (FISP) in wheat: Immunolocalisation in root cells

Abstract

Fusarium induced-stress-protein (FISP) of ～51 kDa molecular mass was detected in seven day old germinated wheat (Triticum aestivum var Sonalika) seedlings infected with F. oxysporum for a period of seven days. This particular stress protein (FISP) of ～51 kDa was over-expressed in the case of Fusarium infected seedlings compared to the untreated seedlings where the presence of this protein was insignificant. Localisation of this ～51 kDa protein in root tissue by anti-CSAP (Cadmium Stress Associated Protein) antiserum showed a significantly higher number of gold particles in the case of Fusarium infected root tissue compared to the untreated control. A unique type of organised localisation of FISP around the plasma membrane and outer vacuolar membrane suggests its defensive role against Fusarium infection that might be a general stress protein against biotic and abiotic stresses.     

An aptasensor for rapid and sensitive detection of estrogen receptor alpha in human breast cancer

The analysis of estrogen receptor (ER) expression in breast carcinomas plays a crucial role in determining the endocrine responsiveness of tumors for systemic adjuvant therapy. Conventionally, the ER levels in breast carcinomas had been detected using the dextran-coated charcoal assay and radioimmunoassay, which are now substituted with safer and economic antibody-based assays such as immunohistochemistry (IHC) and enzyme-linked immunosorbent assay (ELISA). Despite a gold (Au) standard method, the IHC has been criticized for factors such as tissue fixation, antibody selection, and threshold staining for result interpretation that could falsify test accuracy and reproducibility. The quest for alternative methods of ER quantification in tissue samples paved the way for aptamer-based diagnostics. Previously, we have isolated a DNA aptamer against human ER alpha (ERα) using an in vitro evolution system. In this study, we developed an electrochemical sensor using the 76-nucleotide DNA ERα- aptamer for rapid, precise, and cost-effective detection of ERα expression in human breast cancer patients. The aptasensor was constructed by covalently immobilizing the thiolated ERα- aptamer onto a screen-printed Au electrode. Construction of aptasensors was confirmed through atomic force microscopy and differential pulse voltammetry measurements. A detection limit of 0.001 ng/ml was calculated for full-length ERα (66.2 kDa) in a detection time of 10 min. Analysis of the cancerous breast tissue samples using the ELISA and aptasensor methods enabled distinctive classification of samples into the categories of ER −ve, weak ER +ve, and strong ER +ve samples. The current change of this aptasensor lies within 5% after a storage of 60 days at 4°C. Further studies on a reasonably large sample size are required to realize the clinical potential of the sensor.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

The EF-Hand Ca2+ Binding Protein MICU Choreographs Mitochondrial Ca2+ Dynamics in Arabidopsis

Plant organelle function must constantly adjust to environmental conditions, which requires dynamic coordination. Ca²⁺ signaling may play a central role in this process. Free Ca²⁺ dynamics are tightly regulated and differ markedly between the cytosol, plastid stroma, and mitochondrial matrix. The mechanistic basis of compartment-specific Ca²⁺ dynamics is poorly understood. Here, we studied the function of At-MICU, an EF-hand protein of Arabidopsis thaliana with homology to constituents of the mitochondrial Ca²⁺ uniporter machinery in mammals. MICU binds Ca²⁺ and localizes to the mitochondria in Arabidopsis. In vivo imaging of roots expressing a genetically encoded Ca²⁺ sensor in the mitochondrial matrix revealed that lack of MICU increased resting concentrations of free Ca²⁺ in the matrix. Furthermore, Ca²⁺ elevations triggered by auxin and extracellular ATP occurred more rapidly and reached higher maximal concentrations in the mitochondria of micu mutants, whereas cytosolic Ca²⁺ signatures remained unchanged. These findings support the idea that a conserved uniporter system, with composition and regulation distinct from the mammalian machinery, mediates mitochondrial Ca²⁺ uptake in plants under in vivo conditions. They further suggest that MICU acts as a throttle that controls Ca²⁺ uptake by moderating influx, thereby shaping Ca²⁺ signatures in the matrix and preserving mitochondrial homeostasis. Our results open the door to genetic dissection of mitochondrial Ca²⁺ signaling in plants.     

Mass spectrometric characterization of the isoforms in Escherichia coli recombinant DNA-derived interferon alpha-2b

The isoforms Iso-2, Iso-3, and Iso-4 of Escherichia coli-derived recombinant human interferon alpha-2b (rhIFN α-2b), generated by posttranslational modifications of the protein during fermentation, present a major problem in terms of purification and the yield of the drug substance. We report here the structural characterization of these isoforms by mass spectrometry (MS) methods. An extensive MS study was conducted on Iso-4, which is composed of up to 75% of the in-process IFN, and on the native rhIFN α-2b. The trypsin-digested peptide mixtures generated from the two samples were analyzed by liquid chromatography (LC)–MS, and targeted peptides were further studied by LC–tandem MS (triple quadrupole mass spectrometer), high-resolution MSⁿ (LTQ Orbitrap), and matrix-assisted laser desorption/ionization MS (MALDI–MS). The structure of Iso-4 was elucidated as a novel pyruvic acid ketimine derivative of the N-terminal cysteine (Cys1) of IFN α-2b, where the disulfide bond between Cys1 and Cys98 was fully reduced and the other disulfide bond pair, Cys29-ss-Cys138, was partially reduced. Similarly, Iso-2 was identified as a correctly disulfide-folded rhIFN α-2b with acetylation on Cys1, and Iso-3 was identified as an S-glutathionylated form (Cys98) of partially reduced rhIFN α-2b that was pyruvated on Cys1. Based on the characterization work, a reproducible conversion procedure was successfully implemented to convert Iso-4 to rhIFN α-2b.     

Tricyclic 4,4-dimethyl-3,4-dihydrochromeno[3,4-d]imidazole derivatives as microsomal prostaglandin E2 synthase-1 (mPGES-1) inhibitors: SAR and in vivo efficacy in hyperalgesia pain model

A series of substituted tricyclic 4,4-dimethyl-3,4-dihydrochromeno[3,4-d]imidazole derivatives have been synthesized and their mPGES-1 biological activity has been disclosed in detail. Structure-activity relationship (SAR) optimization provided inhibitors with excellent mPGES-1 potency and low to moderate PGE₂ release A549 cell potency. Among the mPGES-1 inhibitors studied, 7, 9 and 11l provided excellent selectivity over COX-2 (>200-fold) and >70-fold selectivity for COX-1 except 11l, which exhibited dual mPGES-1/COX-1 activity. Furthermore, the above tested mPGES-1 inhibitors demonstrated good metabolic stability in liver microsomes, high plasma protein binding (PPB) and no significant inhibition observed in clinically relevant CYP isoforms. Besides, selected mPGES-1 tool compounds 9 and 11l provided good in vivo pharmacokinetic profile and oral bioavailability (%F = 33 and 85). Additionally, the representative mPGES-1 tool compounds 9 and 11l revealed moderate in vivo efficacy in the LPS-induced thermal hyperalgesia guinea pig pain model.