Functional assignment to JEV proteins using SVM

Identification of different protein functions facilitates a mechanistic understanding of Japanese encephalitis virus (JEV) infection and opens novel means for drug development. Support vector machines (SVM), useful for predicting the functional class of distantly related proteins, is employed to ascribe a possible functional class to Japanese encephalitis virus protein. Our study from SVMProt and available JE virus sequences suggests that structural and nonstructural proteins of JEV genome possibly belong to diverse protein functions, are expected to occur in the life cycle of JE virus. Protein functions common to both structural and non-structural proteins are iron-binding, metal-binding, lipid-binding, copper-binding, transmembrane, outer membrane, channels/Pores - Pore-forming toxins (proteins and peptides) group of proteins. Non-structural proteins perform functions like actin binding, zinc-binding, calcium-binding, hydrolases, Carbon-Oxygen Lyases, P-type ATPase, proteins belonging to major facilitator family (MFS), secreting main terminal branch (MTB) family, phosphotransfer-driven group translocators and ATP-binding cassette (ABC) family group of proteins. Whereas structural proteins besides belonging to same structural group of proteins (capsid, structural, envelope), they also perform functions like nuclear receptor, antibiotic resistance, RNA-binding, DNA-binding, magnesium-binding, isomerase (intra-molecular), oxidoreductase and participate in type II (general) secretory pathway (IISP).     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Expression of an apoplast-directed, T-phylloplanin-GFP fusion gene confers resistance against Peronospora tabacina disease in a susceptible tobacco

Key message

Phylloplanins are plant-derived, antifungal glycoproteins produced by leaf trichomes. Expression of phylloplanin-GFP fusion gene to the apoplast of a blue mold susceptible tobacco resulted in increased resistance to this pathogen.

Abstract

Tobaccos and certain other plants secrete phylloplanin glycoproteins to aerial surfaces where they appear to provide first-point-of-contact resistance against fungi/fungi-like pathogens. These proteins can be collected by water washing of aerial plant surfaces, and as shown for tobacco and a sunflower phylloplanins, spraying concentrated washes onto, e.g., turf grass aerial surfaces can provide resistance against various fungi/fungi-like pathogens, in the laboratory. These results suggest that natural-product, phylloplanins may be useful as broad-selectivity fungicides. An obvious question now is can a tobacco phylloplanin gene be introduced into a disease-susceptible plant to confer endogenous resistance. Here we demonstrate that introduction of a tobacco phylloplanin gene—as a fusion with the GFP gene—targeted to the apoplasm can increase resistance to blue mold disease in a susceptible host tobacco.     

Spatiotemporal evaluation of trace elements in river water using multivariate methods

The multivariate statistical methods (cluster analysis and discriminant analysis [DA]) are used to evaluate the quality of water spatiotemporally in the Brahmani River basin. A total of 15 water quality indicators (pH, Chloramines, Sodium, Sulfate, Phosphate, Potassium, Boron, Fluoride, Cadmium, Copper, Lead, Nickel, Zinc, Iron, and Total Chromium) are collected for 13 years in two seasons (the dry and the wet season) from nine sampling stations. These stations are grouped into four clusters (Considerable [Co], Low Pollution [LP], Moderate Pollution [MP], and Extreme Pollution [(EP]) by hierarchical agglomerative cluster analysis based on the similarities of water quality characteristics. The nine important influencing discriminating water quality indicators are extracted by stepwise method of temporal DA,where as eight important influencing indicators for dry season and eight indicators (Potassium, Phosphate, Fluoride, Copper, Lead, Nickel, Iron, and Total Chromium) for wet season are found out by the spatial DA. The pollution status in the river basin was observed from overall trend in (Considerable) Co to (Extreme Pollution) EP regions. The study could be very useful in prioritizing the important sites for water resources and pollution management.     

Binding interaction study on human serum albumin with bactericidal gold nanoparticles synthesized from a leaf extract of Musa balbisiana: a multispectroscopic approach

This study describes the eco‐friendly, low‐cost and room‐temperature synthesis of gold nanoparticles from Musa balbisiana leaf extract, which acts as both reducing and stabilizing agent, and characterized by ultraviolet?visible (UV–vis) light spectroscopy, fourier transform infrared (FTIR) spectroscopy, field emission scanning electron microscopy (FE‐SEM), analytical transmission electron microscopy (TEM), energy‐dispersive X‐ray spectroscopy (EDAX) and dynamic light scattering (DLS) instruments. These nanoparticles showed an average diameter of 33.83 ± 3.39 nm, which was confirmed from the size distribution histogram. The bactericidal activity of these nanoparticles was confirmed using bacteria Escherichia coli and Staphylococcus aureus at 1 and 2 nM minimum inhibitory concentrations, respectively. The interaction between nanoparticles and human serum albumin (HSA) was investigated, as this plays significant roles in biological systems. The nature of interaction, binding parameters and structural variation of HSA in the presence of these nanoparticles have been evaluated using several useful spectroscopic approaches such as UV–vis, FTIR, time‐resolved and steady‐state fluorescence, and circular dichroism in addition to the measurement of zeta potential. This interaction study revealed that static quenching occurs in this process with minimal alteration in the secondary structure, but the native structure of HSA remained unaltered. The binding constant and thermodynamic parameters of this interaction process were also evaluated.     

Developmental Studies in Porphyra Vietnamensis: a High-Temperature Resistant Species from the Indian Coast

Porphyra vietnamensis Tanaka & Pham-Hoang Ho (Bangiales, Rhodophyta) is a tropical seaweed collected from the west coast of India. Thalli of the blade phase are found growing only during the rainy season between July and September. They grow on rocky intertidal or subtidal substrata or as epiphytes on other seaweeds such as Enteromorpha flexuosa and Chaetomorpha media. The gametophytic thallus is monostromatic and covered with spines at the base. The species is monoecious. Male gametangia are found in patches that are distributed in the upper part of the thallus. Archeospores are found at the thallus margins and give rise to the blade phase after one week of germination even at 30 ^∘ C. Zygotospores germinated at 25 ^∘ C into conchocelis within three days from the date of their inoculation. Conchospores were released at 30 ^∘ C. The young blades grew at 32 ^∘ C in the laboratory.     

Word organization in coding DNA: A mathematical model

This article deals with the relationship between vocabulary (total number of distinct oligomers or “words”) and text-length (total number of oligomers or “words”) for a coding DNA sequence (CDS). For natural human languages, Heaps established a mathematical formula known as Heaps' law, which relates vocabulary to text-length. Our analysis shows that Heaps' law fails to model this relationship for CDSs. Here we develop a mathematical model to establish the relationship between the number of type of words (vocabulary) and the number of words sampled (text-length) for CDSs, when non-overlapping nucleotide strings with the same length are treated as words. We use tangent-hyperbolic function, which captures the saturation property of vocabulary. Based on the parameters of the model, we formulate a mathematical equation, known as “equation of word organization”, whose parameters essentially indicate that nucleotide organization of coding sequences are different from one another. We also compare the word organization of CDSs with the random word distribution and conclude that a CDS is neither similar to a natural human language nor to a random one. Moreover, these sequences have their unique nucleotide organization and it is completely structured for specific biological functioning. IM and AS contributed equally to this work.     

Impact of chromate and dichromate on lysozyme stability: A spectroscopic and molecular docking investigation

A comparative study of interaction between chicken egg white lysozyme (Lyz) with two hexavalent chromate ions; chromate and dichromate; which are prevalently known for their toxicity, was investigated using different spectroscopic techniques along with a molecular docking study. Both steady-state and time-resolved studies revealed that the addition of chromate/dichromate is responsible for strong quenching of intrinsic fluorescence in Lyz and the quenching is caused by both static and dynamic quenching mechanisms. Different binding and thermodynamic parameters were also calculated at different temperatures from the intrinsic fluorescence of Lyz. The conformational change in Lyz and thermodynamic parameters obtained during the course of interaction with chromate/dichromate were well-supported by the molecular docking results.