Detection of androclonal variation in anther-cultured rice lines using rapds

Summary Random amplified polymorphic DNA analysis was used to determine the occurrence and extent of variation in rice (Oryza sativa L.) plants regenerated from anther culture. Androclonal variation in morphologically uniform progenies was detected using 40 10-mer oligonueleotide arbitrary primers. Among 27 plants from nine anther culture-derived lines, variation was detected in three plants from two lines by two primers, namely UBC 160 and UBC 209. Primer UBC 160 amplified a polymorphic band on one of the three progenies from DH-34, while UBC 209 detected polymorphisms on two out of three progenies from line DH-58. Apart from these, the amplification produets were monomorphic across all the regenerants from anther culture-derived plants. Out of 40 tested primers, no difference in the banding pattern was observed in three seed-derived plants. The significance of possible androclonal variation at the DNA level in rice doubled haploid breeding and genetic mapping is discussed.     

Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype C

HLA class I-mediated selection of immune escape mutations in functionally important Gag epitopes may partly explain slower disease progression in HIV-1-infected individuals with protective HLA alleles. To investigate the impact of Gag function on disease progression, the replication capacities of viruses encoding Gag-protease from 60 individuals in early HIV-1 subtype C infection were assayed in an HIV-1-inducible green fluorescent protein reporter cell line and were correlated with subsequent disease progression. Replication capacities did not correlate with viral load set points (P = 0.37) but were significantly lower in individuals with below-median viral load set points (P = 0.03), and there was a trend of correlation between lower replication capacities and lower rates of CD4 decline (P = 0.09). Overall, the proportion of host HLA-specific Gag polymorphisms in or adjacent to epitopes was negatively associated with replication capacities (P = 0.04), but host HLA-B-specific polymorphisms were associated with higher viral load set points (P = 0.01). Further, polymorphisms associated with host-specific protective HLA alleles were linked with higher viral load set points (P = 0.03). These data suggest that transmission or early HLA-driven selection of Gag polymorphisms results in reduced early cytotoxic T-lymphocyte (CTL) responses and higher viral load set points. In support of the former, 46% of individuals with nonprotective alleles harbored a Gag polymorphism exclusively associated with a protective HLA allele, indicating a high rate of their transmission in sub-Saharan Africa. Overall, HIV disease progression is likely to be affected by the ability to mount effective Gag CTL responses as well as the replication capacity of the transmitted virus.     

Gag-Protease-Mediated Replication Capacity in HIV-1 Subtype C Chronic Infection: Associations with HLA Type and Clinical Parameters

The mechanisms underlying HIV-1 control by protective HLA class I alleles are not fully understood and could involve selection of escape mutations in functionally important Gag epitopes resulting in fitness costs. This study was undertaken to investigate, at the population level, the impact of HLA-mediated immune pressure in Gag on viral fitness and its influence on HIV-1 pathogenesis. Replication capacities of 406 recombinant viruses encoding plasma-derived Gag-protease from patients chronically infected with HIV-1 subtype C were assayed in an HIV-1-inducible green fluorescent protein reporter cell line. Viral replication capacities varied significantly with respect to the specific HLA-B alleles expressed by the patient, and protective HLA-B alleles, most notably HLA-B*81, were associated with lower replication capacities. HLA-associated mutations at low-entropy sites, especially the HLA-B*81-associated 186S mutation in the TL9 epitope, were associated with lower replication capacities. Most mutations linked to alterations in replication capacity in the conserved p24 region decreased replication capacity, while most in the highly variable p17 region increased replication capacity. Replication capacity also correlated positively with baseline viral load and negatively with baseline CD4 count but did not correlate with the subsequent rate of CD4 decline. In conclusion, there is evidence that protective HLA alleles, in particular HLA-B*81, significantly influence Gag-protease function by driving sequence changes in Gag and that conserved regions of Gag should be included in a vaccine aiming to drive HIV-1 toward a less fit state. However, the long-term clinical benefit of immune-driven fitness costs is uncertain given the lack of correlation with longitudinal markers of disease progression.There is broad heterogeneity in the ability of HIV-infected individuals to control virus replication, ranging from elite controllers, who maintain undetectable viral loads without treatment, to rapid progressors, who progress to AIDS within 2 years of infection (9, 22, 32). Many interrelated factors, including host and viral genetic factors involved in antiviral immunity and the viral life cycle, may partially account for the differences in the course of disease progression (10, 11, 30, 41). The complex interplay between host genetic factors and viral factors is exemplified by human leukocyte antigen (HLA) class I-restricted cytotoxic T-lymphocyte (CTL) responses, which exert considerable immune pressure on the virus, resulting in escape mutations that affect the interaction of viral and host proteins, thereby influencing infection outcome.The exact mechanisms by which some HLA class I alleles, such as HLA-B*57 and HLA-B*27, are associated with slower progression to AIDS, while others, such as B*5802 and B*18, are associated with accelerated disease progression (6, 20, 42), are unclear. The magnitude and/or breadth of HLA-restricted CTL responses to the conserved Gag protein has been correlated inversely with disease progression or markers of disease progression in several studies (12, 21, 28, 31, 35, 43, 46), although there are some exceptions (4, 16, 37), while preferential targeting of the highly variable envelope protein (as occurs in HLA-B*5802-positive individuals) correlates with higher viral loads (21, 29). Protective HLA alleles restrict CTL responses that impose a strong selection pressure on a few specific Gag p24 epitopes, resulting in escape mutations (14) for which fitness costs have been demonstrated either through site-directed mutations introduced into a reference strain background (2, 8, 25, 38) or through in vivo reversion of these mutations after transmission to an HLA-mismatched individual (8, 24). Recent evidence suggests that Gag escape mutations with a fitness cost, particularly those in p24, are a significant determinant of disease progression: the transmitted number of HLA-B-associated polymorphisms in Gag was found to significantly impact the viral set point in recipients (although an associated fitness cost was not shown) (7, 15), and in a small number of infants, decreased fitness of the transmitted virus with HLA-B*5703/5801-selected mutations in Gag p24 epitopes resulted in slower disease progression (33, 39). Also, the number of reverting Gag mutations (thought to revert as a consequence of fitness costs) associated with individual HLA-B alleles was strongly correlated with the HLA-linked viral set point in chronically infected patients (26). A recent in vitro study showed that HLA-associated variation in Gag-protease, with resulting reduced replication capacity, may contribute to viral control in HIV-1 subtype B-infected elite controllers (27). Taken together, these studies suggest that CTL responses restricted by favorable HLA alleles select for escape mutations in conserved epitopes, particularly those in Gag, resulting in a fitness cost to HIV and therefore at least partly explaining the slower disease progression in individuals carrying these alleles.To date, many of the studies investigating the fitness cost of Gag escape mutations and their clinical relevance have concentrated on escape mutations associated with protective HLA alleles, have not assessed fitness consequences in the natural sequence background (in the presence of other escape and compensatory mutations), and/or have focused on a limited number of patients. Most importantly, the majority of studies have focused on HIV-1 subtype B. The present study is the first to use a large population-based approach and clinically derived Gag-protease sequences to investigate comprehensively the relationships between immune-driven sequence variation in Gag, viral replication capacity, and markers of disease progression in chronic infection with HIV-1 subtype C, the most predominant subtype in the epidemic. We assayed the replication capacity of recombinant viruses encoding patient Gag-protease in an HIV-1-inducible green fluorescent protein (GFP) reporter cell line and found associations between lower replication capacities, protective HLA alleles, protective HLA-associated mutations, lower baseline viral loads, and higher baseline CD4 counts. However, Gag-protease replication capacity did not correlate with the subsequent rate of CD4 decline.     

A molecular assay for sensitive detection of pathogen-specific T-cells

Here we describe the development and validation of a highly sensitive assay of antigen-specific IFN-γ production using real time quantitative PCR (qPCR) for two reporters--monokine-induced by IFN-γ (MIG) and the IFN-γ inducible protein-10 (IP10). We developed and validated the assay and applied it to the detection of CMV, HIV and Mycobacterium tuberculosis (MTB) specific responses, in a cohort of HIV co-infected patients. We compared the sensitivity of this assay to that of the ex vivo RD1 (ESAT-6 and CFP-10)-specific IFN-γ Elispot assay. We observed a clear quantitative correlation between the two assays (P<0.001). Our assay proved to be a sensitive assay for the detection of MTB-specific T cells, could be performed on whole blood samples of fingerprick (50 uL) volumes, and was not affected by HIV-mediated immunosuppression. This assay platform is potentially of utility in diagnosis of infection in this and other clinical settings.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

Impact of HLA in Mother and Child on Disease Progression of Pediatric Human Immunodeficiency Virus Type 1 Infection

A broad Gag-specific CD8⁺ T-cell response is associated with effective control of adult human immunodeficiency virus (HIV) infection. The association of certain HLA class I molecules, such as HLA-B*57, -B*5801, and -B*8101, with immune control is linked to mutations within Gag epitopes presented by these alleles that allow HIV to evade the immune response but that also reduce viral replicative capacity. Transmission of such viruses containing mutations within Gag epitopes results in lower viral loads in adult recipients. In this study of pediatric infection, we tested the hypothesis that children may tend to progress relatively slowly if either they themselves possess one of the protective HLA-B alleles or the mother possesses one of these alleles, thereby transmitting a low-fitness virus to the child. We analyzed HLA type, CD8⁺ T-cell responses, and viral sequence changes for 61 mother-child pairs from Durban, South Africa, who were monitored from birth. Slow progression was significantly associated with the mother or child possessing one of the protective HLA-B alleles, and more significantly so when the protective allele was not shared by mother and child (P = 0.007). Slow progressors tended to make CD8⁺ T-cell responses to Gag epitopes presented by the protective HLA-B alleles, in contrast to progressors expressing the same alleles (P = 0.07; Fisher''s exact test). Mothers expressing the protective alleles were significantly more likely to transmit escape variants within the Gag epitopes presented by those alleles than mothers not expressing those alleles (75% versus 21%; P = 0.001). Reversion of transmitted escape mutations was observed in all slow-progressing children whose mothers possessed protective HLA-B alleles. These data show that HLA class I alleles influence disease progression in pediatric as well as adult infection, both as a result of the CD8⁺ T-cell responses generated in the child and through the transmission of low-fitness viruses by the mother.Human immunodeficiency virus (HIV)-specific CD8⁺ T cells play a central role in controlling viral replication (12). It is the specificity of the CD8⁺ T-cell response, particularly the response to Gag, that is associated with low viral loads in HIV infection (7, 17, 34). Although immune control is undermined by the selection of viral mutations that prevent recognition by the CD8⁺ T cells, evasion of Gag-specific responses mediated by protective class I HLA-B alleles typically brings a reduction in viral replicative capacity, facilitating subsequent immune control of HIV (2, 20, 21). The same principle has been demonstrated in studies of simian immunodeficiency virus infection (18, 22).Recent studies showed that the class I HLA-B alleles that protect against disease progression present more Gag-specific CD8⁺ T-cell epitopes and drive the selection of more Gag-specific escape mutations than those alleles that are associated with high viral loads (23). These protective HLA-B alleles not only are beneficial to infected individuals expressing those alleles but also benefit a recipient following transmission, since the transmitted virus carrying multiple Gag escape mutations may have substantially reduced fitness (3, 4, 8). However, there is no benefit to the recipient if he or she shares the same protective allele as the donor because the transmitted virus carries escape mutations in the Gag epitopes that would otherwise be expected to mediate successful immune control in the recipient (8, 11).The sharing of HLA alleles between donor and recipient occurs frequently in mother-to-child transmission (MTCT). The risk of MTCT is related to viral load in the mother, and a high viral load is associated with nonprotective alleles, such as HLA-B*18 and -B*5802. This may contribute in two distinct ways to the more rapid progression observed in pediatric HIV infection (24, 26, 27). First, because infected children share 50% or more of their HLA alleles with the transmitting mother, they are less likely than adults to carry protective HLA alleles (16). Thus, infected children as a group carry fewer protective HLA alleles and more nonprotective HLA alleles. Second, even when the child has a protective allele, such as HLA-B*27, this allele does not offer protection if the maternally transmitted virus carries escape mutations within the key Gag epitopes that are presented by the protective allele (11, 19).However, it is clear that infected children who possess protective alleles, such as HLA-B*27 or HLA-B*57, can achieve durable immune control of HIV infection if the virus transmitted from the mother is not preadapted to those alleles (6, 10). HIV-specific CD8⁺ T-cell responses are detectable from birth in infected infants (32). Furthermore, as in adult infection (3, 8), HIV-infected children have the potential to benefit from transmission of low-fitness viruses in the situation where the mother possesses protective HLA alleles and the child does not share those protective alleles. MTCT of low-fitness viruses carrying CD8⁺ T-cell escape mutations was recently documented (28; J. Prado et al., unpublished data).In this study, undertaken in Durban, South Africa, we set out to test the hypothesis that HIV-infected children are less likely to progress rapidly to disease if either the infected child or the transmitting mother possesses a protective HLA allele that is not shared. The HLA alleles most strongly associated with low viral loads and high CD4 counts in a cohort of >1,200 HIV-infected adults in Durban are HLA-B*57 (-B*5702 and -B*5703), HLA-B*5801, and HLA-B*8101 (16; A. Leslie et al., unpublished data). These four alleles all present Gag-specific CD8⁺ T-cell epitopes, and in each case the escape mutations selected in these epitopes reduce viral replicative capacity (2-4, 8, 21, 23).Analyzing a previously described cohort of 61 HIV-infected children in Durban (24, 26, 32), South Africa, who were all monitored from birth, we first addressed the question of whether possession of any of these four alleles by either mother or child is associated with slower disease progression in the child and then determined whether sharing of protective alleles by mother and child affects the ability of the child to make the Gag-specific CD8⁺ T-cell responses restricted by the shared allele.