Chemical modifications of imidazole-containing alkoxyamines increase C–ON bond homolysis rate: Effects on their cytotoxic properties in glioblastoma cells

Previously, we described alkoxyamines bearing a pyridine ring as new pro-drugs with low molecular weights and theranostic activity. Upon chemical stimulus, alkoxyamines undergo homolysis and release free radicals, which can, reportedly, enhance magnetic resonance imaging and trigger cancer cell death. In the present study, we describe the synthesis and the anti-cancer activity of sixteen novel alkoxyamines that contain an imidazole ring. Activation of the homolysis was conducted by protonation and/or methylation. These new molecules displayed cytotoxic activities towards human glioblastoma cell lines, including the U251-MG cells that are highly resistant to the conventional chemotherapeutic agent Temozolomide. We further showed that the biological activities of the alkoxyamines were not only related to their half-life times of homolysis. We lastly identified the alkoxyamine (RS/SR)-4a, with both a high antitumour activity and favourable logD_7.4 and pK_a values, which make it a robust candidate for blood-brain barrier penetrating therapeutics against brain neoplasia.     

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.     

metaGEM: reconstruction of genome scale metabolic models directly from metagenomes

Metagenomic analyses of microbial communities have revealed a large degree of interspecies and intraspecies genetic diversity through the reconstruction of metagenome assembled genomes (MAGs). Yet, metabolic modeling efforts mainly rely on reference genomes as the starting point for reconstruction and simulation of genome scale metabolic models (GEMs), neglecting the immense intra- and inter-species diversity present in microbial communities. Here, we present metaGEM (https://github.com/franciscozorrilla/metaGEM), an end-to-end pipeline enabling metabolic modeling of multi-species communities directly from metagenomes. The pipeline automates all steps from the extraction of context-specific prokaryotic GEMs from MAGs to community level flux balance analysis (FBA) simulations. To demonstrate the capabilities of metaGEM, we analyzed 483 samples spanning lab culture, human gut, plant-associated, soil, and ocean metagenomes, reconstructing over 14,000 GEMs. We show that GEMs reconstructed from metagenomes have fully represented metabolism comparable to isolated genomes. We demonstrate that metagenomic GEMs capture intraspecies metabolic diversity and identify potential differences in the progression of type 2 diabetes at the level of gut bacterial metabolic exchanges. Overall, metaGEM enables FBA-ready metabolic model reconstruction directly from metagenomes, provides a resource of metabolic models, and showcases community-level modeling of microbiomes associated with disease conditions allowing generation of mechanistic hypotheses.     

Diet variability among insular populations of Podarcis lizards reveals diverse strategies to face resource‐limited environments

Access to resources is a dynamic and multicausal process that determines the success and survival of a population. It is therefore often challenging to disentangle the factors affecting ecological traits like diet. Insular habitats provide a good opportunity to study how variation in diet originates, in particular in populations of mesopredators such as lizards. Indeed, high levels of population density associated with low food abundance and low predation are selection pressures typically observed on islands. In the present study, the diet of eighteen insular populations of two closely related species of lacertid lizards (Podarcis sicula and Podarcis melisellensis) was assessed. Our results reveal that despite dietary variability among populations, diet taxonomic diversity is not impacted by island area. In contrast, however, diet disparity metrics, based on the variability in the physical (hardness) and behavioral (evasiveness) properties of ingested food items, are correlated with island size. These findings suggest that an increase in intraspecific competition for access to resources may induce shifts in functional components of the diet. Additionally, the two species differed in the relation between diet disparity and island area suggesting that different strategies exist to deal with low food abundance in these two species. Finally, sexual dimorphism in diet and head dimensions is not greater on smaller islands, in contrast to our predictions.     

Discontinuity surfaces recorded in shallow-marine platform carbonates: an example from the Early Jurassic of the Velebit Mt. (Croatia)

Discontinuity surfaces of different types and scales are common in successions of shallow-marine carbonate platforms because sediments there are deposited close to the sea level and therefore are sensitive to any significant physico-chemical changes of environmental factors. Discontinuity surfaces indicate breaks in sedimentation under subaqueous or subaerial conditions. Most discontinuities in shallow-marine carbonate successions are on a bed-scale, and can be determined only by analysis of sedimentologic, diagenetic, taphonomic, and ichnologic features of the rock. The study of small-scale discontinuities has been carried out on two Lower Jurassic successions of the Velebit Mt. Depending upon their common features and environment of formation, three groups of discontinuities are distinguished on simple bedding planes: subaerial exposure surfaces, erosion surfaces, and omission surfaces. The distribution of discontinuity types in both successions is evaluated. Exposure surfaces prevail in both sections, and four units (relatively thin intervals of the sedimentary record) with abundant subaerial exposures are recognized. Dated by biostratigraphy, these units are of earliest Sinemurian, middle Early Sinemurian, earliest Pliensbachian, and late Early Pliensbachian age. Omission surfaces are the least common type of discontinuity. Thickness variations of high-frequency peritidal and shallow subtidal shallowing-upward cycles, highlighted by the Fischer plots show a very similar long-term trend for the two sections. The units with common subaerial exposure surfaces coincide with the falling limb of the Fischer plots and the section with common omission surfaces coincides with the rising limb of the plots. The studied discontinuities are formed by autocyclic and/or allocyclic processes operating on the shallow platform, but the units with abundant subaerial exposures invoke allogenic forcing of the sedimentary record. The use of the units with abundant discontinuities instead of a single surface has proven useful for the correlation of the studied shallow-platform deposits because one type of discontinuity may change laterally into another type or features of different discontinuity types can be superimposed.     

Progesterone and Wnt4 control mammary stem cells via myoepithelial crosstalk

Ovarian hormones increase breast cancer risk by poorly understood mechanisms. We assess the role of progesterone on global stem cell function by serially transplanting mouse mammary epithelia. Progesterone receptor (PR) deletion severely reduces the regeneration capacity of the mammary epithelium. The PR target, receptor activator of Nf‐κB ligand (RANKL), is not required for this function, and the deletion of Wnt4 reduces the mammary regeneration capacity even more than PR ablation. A fluorescent reporter reveals so far undetected perinatal Wnt4 expression that is independent of hormone signaling. Pubertal and adult Wnt4 expression is specific to PR⁺ luminal cells and requires intact PR signaling. Conditional deletion of Wnt4 reveals that this early, previously unappreciated, Wnt4 expression is functionally important. We provide genetic evidence that canonical Wnt signaling in the myoepithelium required PR and Wnt4, whereas the canonical Wnt signaling activities observed in the embryonic mammary bud and in the stroma around terminal end buds are independent of Wnt4. Thus, progesterone and Wnt4 control stem cell function through a luminal–myoepithelial crosstalk with Wnt4 acting independent of PR perinatally.     

Effect of competition on habitat utilization in two temperate climate gecko species

Competition over spatial niche utilisation is one of most common competitive interactions between species in sympatry. Moreover, competitive interactions may involve age classes, and can fluctuate temporally. Consequently, evasive strategies that enable co-existence are likely to be important in the evolution of species assemblages. Here we investigate a system of two co-existing species of temperate geckos with similar ecologies (the house gecko, Hemidactylus turcicus and the wall gecko, Tarentola mauritanica), providing an opportunity to study the effect of species interactions. Juveniles and adults of both species were investigated throughout their daily and annual cycle to explore the effect of inter- and intra-specific interactions on microhabitat use. The two species showed differences in habitat use for both age classes in sympatry. In sympatry, T. mauritanica uses more open habitats and is more active. In contrast, H. turcicus is found in more closed habitats, closer to the ground and to vegetation cover. In allopatry, H. turcicus was observed in more open habitats, closer to the ground, and to vegetation cover, when compared to the population in sympatry with T. mauritanica. These differences in habitat usage were significant for both age classes. Moreover, there were differences, both in sympatry and in allopatry, between age classes that were dependent on season. In conclusion, the presence of a competitor induces a spatial shift in individuals of both age classes of H. turcicus. Observed plasticity in habitat utilisation in both age classes of H. turcicus is used to argue for the invasive potential of this species.