Post-translational acquisition of insulin binding activity by the insulin proreceptor. Correlation to recognition by autoimmune antibody

The post-translational acquisition of ligand binding activity by the insulin receptor was examined in 3T3-L1 adipocytes. In pulse-chase experiments with [35S] methionine, labeled receptor species were separated into "active" and "inactive" forms by affinity chromatography on insulin-agarose and then were characterized and quantitated. It was found that the newly translated high molecular weight proreceptor lacks the capacity to bind insulin. The acquisition of binding activity is relatively slow (t1/2 = 45 min) and occurs prior to conversion of the proreceptor to the mature alpha- and beta-subunits by proteolytic cleavage and maturation of its N-linked oligosaccharide chains (t1/2 = 3 h). Glycosylation appears to be required for this activation since the aglycoproreceptor, synthesized in the presence of tunicamycin, does not acquire insulin binding activity. However, once the proreceptor has acquired ligand binding activity, removal of its N-linked oligosaccharide chains with endoglycosidase H has no effect on the ability of the proreceptor to bind insulin. The modification of the proreceptor to bind insulin. The modification of the proreceptor that gives rise to insulin binding activity most likely involves a conformational change in the binding domain. A human autoimmune antibody that recognizes only the active insulin binding site does not interact with the inactive proreceptor, whereas a rabbit polyclonal antireceptor antibody recognizes all forms. Thus, the autoimmune antibody must recognize a new epitope created during conversion of the inactive proreceptor to the active form.     

Spasmodic, a mutation on chromosome 11 in the mouse

A new recessive mutation, spasmodic (spd), producing behavior that mimics that of the neurological mutation spastic (spa) with rapid tremors, stiff posture, and difficulty in righting, arose spontaneously in strain A/HeJ at the Jackson Laboratory in 1979. It is not an allele of spa and linkage tests show that this mutation is located close to vestigial tail (vt) near the center of chromosome 11. Additional genetic tests show that it is not an allele of trembler (Tr), shaker-2 (sh-2), nor vibrator (vb), all neurological mutations located in the same region of chromosome 11. No differences were observed in the levels of the major CNS and PNS myelin proteins or lipids of spd/spd mice versus littermate controls, suggesting that, unlike several closely linked mutations, the spd mutation does not affect myelination. Pharmacological studies reported here show that aminooxyacetic acid improves the behavioral abnormalities of affected spd/spd mice in the same way it improves the behavior of affected spa/spa mice. However, unlike the spa/spa mice, there are no changes in the postsynaptic receptors for glycine, GABA, or benzodiazepines in spd/spd mice.     

Sera from HTLV-III/LAV antibody-positive individuals mediate antibody-dependent cellular cytotoxicity against HTLV-III/LAV-infected T cells

The causative agent of the acquired immunodeficiency syndrome (AIDS) has been shown to be a human retrovirus called human T lymphotropic virus (HTLV)-III or lymphadenopathy-associated virus (LAV). The nature of the protective immune response against this virus is currently unknown. We report here results using an antibody-dependent cellular cytotoxicity (ADCC) assay which has been developed for measuring a specific immune response against HTLV-III/LAV. Forty-four sera were examined for their ability to mediate ADCC against HTLV-III/LAV-infected T cells. Sera from healthy HTLV-III/LAV seropositive individuals in the presence of mononuclear cells from healthy HTLV-III/LAV seronegative donors exhibited significantly higher levels of ADCC activity compared to sera from patients with AIDS. Western blot analysis of serum samples indicated that antibody reactivity with the p24 protein of HTLV-III/LAV correlated with higher levels of ADCC activity than did reactivity with Gp120/160. The observation that sera from healthy HTLV-III/LAV seropositive individuals mediated higher levels of ADCC activity than did sera obtained from subjects with AIDS suggests that ADCC may represent a protective immune response to infection with HTLV-III/LAV.     

Enhanced interferon-alpha/beta (IFN-alpha/beta) and defective IFN-gamma production in chronic graft versus host disease: a potential mechanism for immunosuppression

Immunosuppression is a well-characterized consequence of chronic graft-versus-host disease (GVHD). We have previously shown that interferon (IFN) is produced in high levels during acute GVHD. Our objective in this study was to determine if IFN, as a cytokine with known immunosuppressive qualities, could be detected in mice experiencing chronic GVHD-induced immunosuppression. Two different experimental models were used to induce chronic GVHD. The first model involved the injection of parental strain spleen cells into adult F1 hybrids (AJ----B6AF1), while the second model utilized GVHD induced across minor histocompatibility barriers (B10.D2----BALB/c). Results indicated that significant levels of serum IFN-alpha/beta are present in mice undergoing chronic GVHD. Spleen cells from chronic GVHD mice were also shown to produce significant levels of IFN-alpha/beta upon in vitro culture in medium only. This IFN-alpha/beta production was greatly increased when GVHD spleen cells were cultured with either concanavalin A (Con A) or IL-2. In contrast, IFN-gamma production was undetectable in these Con A- or IL-2-containing cultures. Additionally, these same spleen cells which produced high levels of IFN-alpha/beta were immunosuppressed as measured by mitogen-induced cell proliferation. These results suggest that IFN-gamma production is defective in GVHD spleen cells, and that the presence of high IFN-alpha/beta production by GVHD mice may contribute to the immunosuppression associated with chronic GVHD.     

The adenovirus Ela gene induces differentiation of F9 teratocarcinoma cells.

Undifferentiated F9 cells transfected with plasmids encoding adenovirus E1a gene products underwent radical morphological changes. They ceased to express the SSEA-1 stem cell marker antigen and started to express a number of the characteristics of the differentiated state that is induced in F9 cells by treatment with retinoic acid. In particular, they expressed keratin intermediate filaments and acquired the ability to synthesise simian virus 40 tumor antigens after virus infection. The transfected cells expressed the E1a proteins, and this expression was necessary to induce the phenotypic changes, since a coisogenic plasmid encoding only a truncated 70-amino-acid E1a polypeptide and the transfection procedure itself did not detectably after the morphology or marker expression of the F9 stem cells. The phenotypic change was induced by both 13S and 12S cDNA plasmids. We discuss these results in the context of known E1a functions and with reference to the other oncogenes and external factors that can cause F9 cell differentiation.     

Anti-thrombin activities of heparin. Effect of saccharide chain length on thrombin inhibition by heparin cofactor II and by antithrombin.

The interactions of two proteinase inhibitors, heparin cofactor II and antithrombin, with thrombin are potentiated by heparin. Using two methods, we have studied the potentiating effects of a series of heparin (poly)saccharides with high affinity for antithrombin and mean Mr ranging from approx. 1700 to 18,800. First, catalytic amounts of heparin (poly)saccharide were added to purified systems containing thrombin and either heparin cofactor II or antithrombin. Residual thrombin activity was determined with a chromogenic substrate. It was found that only the higher-Mr polysaccharides (Mr greater than 8000) efficiently catalysed thrombin inhibition by heparin cofactor II, there being a progressive catalytic effect with increasing Mr of the polysaccharide. Weak accelerating effects were noted with low-Mr saccharides (Mr less than 8000). This contrasted with the well-characterized interaction of heparin with antithrombin and thrombin, where heparin oligosaccharides of Mr less than 5400 had absolutely no ability to accelerate the reaction, while (poly)saccharides of Mr exceeding 5400 showed rapidly increasing catalytic activity with increasing Mr. Secondly, these and other heparin preparations were added in a wide concentration range to plasma with which 125I-labelled thrombin was then incubated for 30 s. Inhibited thrombin was determined from the distribution of labelled thrombin amongst inhibitor-thrombin complexes, predominantly antithrombin-thrombin and heparin cofactor II-thrombin complexes. In this situation, where the inhibitors competed for thrombin and for the (poly)saccharides, it was found that, provided the latter were of high affinity for antithrombin and exceeded a Mr of 5400, thrombin inhibition in plasma was mediated largely through antithrombin. Polysaccharides of Mr exceeding 8000 that were of low affinity for antithrombin accelerated thrombin inhibition in plasma through their interaction with heparin cofactor II. High concentrations of saccharides of Mr 1700-5400 exhibited a size-dependent acceleration of thrombin inhibition, not through their interaction with antithrombin, but through their interaction with heparin cofactor II.     

N.m.r. assignments and temperature-dependent conformational transitions of a mutant trp operator-promoter in solution.

A total of 145 protons in the mutant trp operator-promoter sequence CGTACTGATTAATCAGTACG were assigned by one-dimensional and two-dimensional n.m.r. methods. Except at the sites of mutation (underlined), the chemical shifts and other n.m.r. parameters are very similar to those observed in the symmetrized wild-type sequence [Lefèvre, Lane & Jardetzky (1987) Biochemistry 26, 5076-5090]. Spin-spin-relaxation rate constants of the resolved base protons and intra- and inter-nucleotide nuclear-Overhauser-enhancement intensities argue for a sequence-dependent structure similar to that of the wild-type, except at and close to the sites of the mutation. The overall tumbling time as a function of temperature was determined from cross-relaxation rate constants for the H-6-H-5 vectors of the four cytosine residues. The values are consistent with the oligonucleotide maintaining a double-helical conformation over the entire temperature range 5-45 degrees C, and that internal motions of the bases are of small amplitude on the subnanosecond time scale. The temperature-dependence of chemical shifts, spin-spin-relaxation rate constants and cross-relaxation rate constants show the occurrence of two conformational transitions localized to the TTAA sequence in the centre of the molecule. The thermodynamics of the transition at the lower temperature (tm = 16 degrees C) were analysed according to a two-state process. The mid-point temperature is about 6 degrees C higher than in the wild-type sequence. The conformational transition does not lead to rupture of the Watson-Crick hydrogen bonds, but probably involves changes in the propellor twists of T.A-9 and T.A-10. The second transition occurs at about 40 degrees C, but cannot be fully characterized. This conformational variability seems to be a property of the sequence TTAA, and may have functional significance in bacterial promoters.     

Nuclear protein p68 is an RNA-dependent ATPase.

The human nuclear antigen p68 cross reacts with a monoclonal antibody to SV40 large-T antigen. Its deduced amino acid sequence contains short motifs which place it in a large superfamily of proteins of known or putative helicase activity. Recently, a p68 subfamily (DEAD box proteins) which share more extensive regions of homology has been identified in mouse, Drosophila, Saccharomyces cerevisiae and Escherichia coli. These proteins are involved in translation, ribosome assembly, mitochondrial splicing, spermatogenesis and embryogenesis. We show here that immunopurified human p68 has RNA dependent ATPase activity. In addition, we show that the protein undergoes dramatic changes in cellular location during the cell cycle.     

Transient expression of simple epithelial keratins by mesenchymal cells of regenerating newt limb

Structural proteins of the intermediate filament family are an early indicator of differentiation before organogenesis becomes apparent. Keratin intermediate filaments are characteristically expressed only by epithelial and not by mesenchymal cells. Here we show, using monoclonal antibodies, a transient expression of the keratin pair 8 and 18 in a population of mesenchymal cells in the regenerating newt limb, specifically in the undifferentiated progenitor cells (blastemal cells) which give rise to the new tissues. These keratins are also expressed in cultured limb cells that can differentiate into muscle. In contrast no reactivity with anti-keratin 8 and 18 antibodies was observed in the newt limb bud at an early stage of development, indicating a molecular difference between the developing and regenerating limb. The molecular weights of the newt proteins detected by these antibodies are very similar to those of human keratins 8 and 18, further supporting the immunocytochemical evidence that the newt homologs of these keratins are expressed in blastemal cells. This is the first demonstration of keratin expression in mesenchymal progenitor cells in an adult animal.