Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Multifaceted applications of nanomaterials in cell engineering and therapy

Nanomaterials with superior physiochemical properties have been rapidly developed and integrated in every aspect of cell engineering and therapy for translating their great promise to clinical success. Here we demonstrate the multifaceted roles played by innovatively-designed nanomaterials in addressing key challenges in cell engineering and therapy such as cell isolation from heterogeneous cell population, cell instruction in vitro to enable desired functionalities, and targeted cell delivery to therapeutic sites for prompting tissue repair. The emerging trends in this interdisciplinary and dynamic field are also highlighted, where the nanomaterial-engineered cells constitute the basis for establishing in vitro disease model; and nanomaterial-based in situ cell engineering are accomplished directly within the native tissue in vivo. We will witness the increasing importance of nanomaterials in revolutionizing the concept and toolset of cell engineering and therapy which will enrich our scientific understanding of diseases and ultimately fulfill the therapeutic demand in clinical medicine.     

Impact of virus preparation quality on parvovirus filter performance

Virus‐removal filtration technology is commonly used in the manufacturing process for biologics to remove potential viral contaminants. Virus‐removal filters designed for retaining parvovirus, one of the smallest mammalian viruses, are considered an industry standard as they can effectively remove broad ranges of viruses. It has long been observed that the performance of virus filters can be influenced by virus preparations used in the laboratory scale studies (PDA, 2010 ). However, it remains unclear exactly what quality attributes of virus preparations are critical or indicative of virus filter performance as measured by effectiveness of virus removal and filter capacity consistency. In an attempt to better understand the relationship between virus preparation and virus filter performance, we have systematically prepared and analyzed different grades of parvovirus with different purity levels and compared their performance profiles on Viresolve® Pro parvovirus filters using four different molecules. Virus preparations used in the studies were characterized using various methods to measure DNA and protein content as well as the hydrodynamic diameter of virus particles. Our results indicate that the performance of Viresolve® Pro filters can be significantly impacted depending on the purity of the virus preparations used in the spike and recovery studies. More importantly, we have demonstrated that the purity of virus preparations is directly correlated to the measurable biochemical and biophysical properties of the virus preparations such as DNA and protein content and monodispersal status, thus making it possible to significantly improve the consistency and predictability of the virus filter performance during process step validations. Biotechnol. Bioeng. 2013; 110: 229–239. © 2012 Wiley Periodicals, Inc.     

Relevance of signaling molecules for apoptosis induction on influenza A virus replication

Apoptosis is an important mechanism to maintain homeostasis in mammals, and disruption of the apoptosis regulation mechanism triggers a range of diseases, such as cancer, autoimmune diseases, and developmental disorders. The severity of influenza A virus (IAV) infection is also closely related to dysfunction of apoptosis regulation. In the virus infected cells, the functions of various host cellular molecules involved in regulation of induction of apoptosis are modulated by IAV proteins to enable effective virus replication. The modulation of the intracellular signaling pathway inducing apoptosis by the IAV infection also affects extracellular mechanisms controlling apoptosis, and triggers abnormal host responses related to the disease severity of IAV infections. This review focuses on apoptosis related molecules involved in IAV replication and pathogenicity, the strategy of the virus propagation through the regulation of apoptosis is also discussed.     

Exploring the effects of immunity and life history on the dynamics of an endogenous retrovirus

Mammalian DNA is littered with the signatures of past retroviral infections. For example, at least 8% of the human genome can be attributed to endogenous retroviruses (ERVs). We take a single-locus approach to develop a simple susceptible–infected–recovered model to investigate the circumstances under which a disease-causing retrovirus can become incorporated into the host genome and spread through the host population if it were to confer an immunological advantage. In the absence of any fitness benefit provided by the long terminal repeat (LTR), we conclude that signatures of ERVs are likely to go to fixation within a population when the probability of evolving cellular/humoral immunity to a related exogenous version of the virus is extremely small. We extend this model to examine whether changing the speed of the host life history influences the likelihood that an exogenous retrovirus will incorporate and spread to fixation. Our results reveal the parameter space under which incorporation of exogenous retroviruses into a host genome may be beneficial to the host. In our final model, we find that the likelihood of an LTR reaching fixation in a host population is not strongly affected by host life history.