Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Dynamics of Belonolaimus longicaudatus Parasitism on a Susceptible St. Augustinegrass Host

St. Augustinegrass (Stenotaphrum secundatum) cv FX-313 was used as a model laboratory host for monitoring population growth of the sting nematode, Belonolaimus longicaudatus, and for quantifying the effects of sting nematode parasitism on host performance in two samples of autoclaved native Margate fine sand with contrasting amounts of organic matter (OM = 7.9% and 3.8%). Following inoculation with 50 Belonolaimus longicaudatus per pot, nematodes peaked at a mean of 2,139 nematodes per pot 84 days after inoculation, remained stable through 168 days at 2,064 nematodes per pot, and declined at 210 days. The relative numbers of juveniles and adults demonstrated senescence after 84 days. Root dry weight of nematode-inoculated plants increased briefly to an apparent equilibrium 84 days after inoculation, whereas root weights of uninoculated controls continued to increase, exceeding those of inoculated plants from 84 to 210 days (P < 0.01). At 210 days, uninoculated plants had 227% the root dry weight of inoculated plants. Transpiration of FX-313 was reduced by nematodes (P < 0.0001) at 84 and 126 days after inoculation; reduction was first observed at 42 days and last observed 168 days after inoculation (P < 0.05). OM content affected all plant performance variables at multiple dates, and generally there were no inoculation x OM content interactions. OM content had no effect on nematode numbers per pot, although there was a slight (P < 0.05) increase in the number of nematodes per gram root dry weight in the low-OM soil compared with the high-OM soil.     

Liverwort genomes display extensive structural variations

PIKE, L. M., HU, A., RENZAGLIA, K. S. & MUSICH, P. R., 1992. Liverwort genomes display extensive structural variations. Analyses of the total genomic DNA of eight species of liverworts and two species of green algae by thermal denaturation and CsCl buoyant density gradient centrifugation reveal a high degree of structural complexity and interspecific heterogeneity. The hepatic taxa exhibit two or more DNA components of varying base composition. Average G4-C contents of total cellular DNA calculated from melting profiles are similarly variable, ranging from 38% to 53% G + C. The green alga Chara , a member of the ancestral line to land plants, shows similarities with liverworts in possessing multiple DNA components of comparable complexity, whereas Hydrodiciyon DNA displays a single component. Detailed hybridization analyses of individual density gradient fractions using α-tubulin, rRNA and ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene probes were performed to locate the low-copy number and moderately repetitive nuclear genes, and the chloroplast chromosome, respectively. The location of each gene within the density gradient is highly variable among the organisms examined; a-tubulin occurs in fractions ranging from 44–64% G + C, rDNA in 50–64% G + C fractions, and the RbcL gene is located in fractions from 30–59% G + C. For a given species, the two nuclear genes normally overlap in their distributions within the gradient. In most instances, neither gene occurs in the major DNA components, indicating that these components may contain repetitive DNAs. The observed variation in the density of the rbcL gene implies substantial reorganization of the chloroplast genome. The overall differences in the genomic components within and between taxa provide insight into the dynamics of DNA structure that have occurred during the extended evolutionary history of these organisms.     

Competitive exclusion,or species aggregation?

Summary There is a long-standing dispute over whether the analysis of species co-occurrence data, typically on islands in an archipelago, can disclose the forces at work in structuring a community. Here we present and utilise three scores S, C and T. S gives the mean number of islands shared by a species pair in the presence/absence data under study. The scores C and T are based on the way that a pair of species occurs on a pair of islands. When each species occurs on a different island, this adds to the checkerboard score C; if they occupy the same island, this increases the togetherness score T.In judging whether observed values of S, C and T are compatible with a null hypothesis assuming no species interaction, we follow Connor and Simberloff (1979) in generating a control group of (constrained) simulated incidence patterns.Presence/absence matrices can have paradoxical features, in combining a high mutual exclusion by species (checkerboardedness) with a degree of species aggregation that is also high. We show that this is in fact inevitable — that, given the usual contraints, C and T can differ only by a constant. This means that extreme checkerboardedness can be produced by forces making for species aggregation, just as well as by those making for avoidance.If we restrict our attention to a subset of species, the constraints are less rigid and the S, C and T scores are somewhat freer to vary. We consider the confamilial subsets in the Vanuatu archipelago as likely candidates for revealing any competition forces at work. Calculating the actual S, C and T scores for these subsets, we compare them with the corresponding scores in a sample of simulated colonization patterns.The actual species-distributions differ significantly from what we would expect if the colonization choices of different species were uncorrelated (save for some biological constraints). The confamilial species of the real world share more islands, and occur in a pattern less checkerboarded, and more aggregated, than their simulation counterparts. This suggests that competition pressures, if they exist, are overcome by countervailing factors.The method used is applicable in other ways, and to a wider class of problems, in analysing the forces behind community structure.     

Density dependent interactions between VA mycorrhizal fungi and even-aged seedlings of two perennial Fabaceae species

Summary The interaction of density and mycorrhizal effects on the growth, mineral nutrition and size distribution of seedlings of two perennial members of the Fabaceae was investigated in pot culture. Seedlings of Otholobium hirtum and Aspalathus linearis were grown at densities of 1, 4, 8 and 16 plants per 13-cm pot with or without vesicular-arbuscular (VA) mycorrhizal inoculum for 120 days. Plant mass, relative growth rates, height and leaf number all decreased with increasing plant density. This was ascribed to the decreasing availability of phosphorus per plant as density increased. O. hirtum was highly dependent on mycorrhizas for P uptake but both mycorrhizal and non-mycorrhizal A. linearis seedlings were able to extract soil P with equal ease. Plant size distribution as measured by the coefficient of variation (CV) of shoot mass was greater at higher densities. CVs of mycorrhizal O. hirtum plants were higher than those of non-mycorrhizal plants. CVs of the facultatively mycorrhizal A. linearis were similar for both mycorrhizal and non-mycorrhizal plants. Higher CVs are attributed to resource preemption by larger individuals. Individuals in populations with high CVs will probably survive stress which would result in the extinction of populations with low CVs. Mass of mycorrhizal plants of both species decreased more rapidly with increasing density than did non-mycorrhizal plant mass. It is concluded that the cost of being mycorrhizal increases as plant density increases, while the benefit decreases. The results suggest that mycorrhizas will influence density-dependent population processes of faculative and obligate mycorrhizal species.     

The role of the hemiparasitic annual Rhinanthus minor in determining grassland community structure

Summary Rhinanthus minor (yellow-rattle) is a widespread hemiparasitic plant of grassland habitats throughout Great Britain. It is usually considered to be indicative of species-rich grassland, but in a survey of 14 habitats throughout Britain it was found that R. minor at the time of flowering normally occupied relatively low-diversity patches within areas of high diversity as determined by the number of species, Simpson's Index and the Shannon-Wiener Index. Following the death of adult plants of R. minor in the summer it was shown that the pattern of species diversity changed such that by the time R. minor germinated in the following spring the differences between the areas containing and not containing R. minor were much less distinct. A perturbation experiment in which R. minor was removed from four sites indicated that the effect of the removal of R. minor on the development of community structure over the next year was to increase species diversity on three of the sites and decrease it on the fourth. Those species which responded to the removal of R. minor by an increase in abundance were shown to be preferred hosts. All three lines of evidence point to the fact R. minor has a significant effect on the species diversity of the communities in which it grows by selectively parasitizing components of the flora and modifying the competitive relationships between plants. However, as the communities generally responded to the removal of R. minor by an increase in diversity and as the general survey indicated that R. minor is generally associated with areas of low diversity it would appear that the plants which are selectively parasitized are generally not the competitive dominants in the community.     

Similarity of maize and sorghum genomes as revealed by maize RFLP probes

Summary Densely saturated genetic maps of neutral genetic markers are a prerequisite either for plant breeding programs to improve quantitative traits in crops or for evolutionary studies. cDNA and genomic clones from maize were utilized to initiate the construction of a RFLP linkage map in Sorghum bicolor. To this purpose, an F₂ population was produced from starting parental lines IS 18729 (USA) and IS 24756 (Nigeria) that were differentiated with regard to many morphological and agronomical traits. A total of 159 maize clones were hybridized to the genomic DNA of the two parents in order to detect polymorphism: 154 probes hybridized to sorghum and 58 out of these were polymorphic. In almost all of the cases hybridization patterns were similar between maize and sorghum. The analysis of the segregation of 35 polymorphic clones in an F₂ population of 149 individuals yielded five linkage groups. The three principal ones recall regions of maize chromosomes 1, 3 and 5: in general, colinearity was maintained. A possible inversion, involving a long region of maize chromosome 3, was detected. Simulations were also performed to empirically obtain a value for the lowest number of individuals of the F₂ population needed to obtain the same linkage data.Prof. E. Ottaviano, to whom this paper is dedicated, suddenly died on June 7^th, 1991     

Characterization of genetic identities and relationships of Brassica oleracea L. via a random amplified polymorphic DNA assay

Summary Effective conservation and the use of plant genetic resources are essential for future agricultural progress. Critical to this conservation effort is the development of genetic markers which not only distinguish individuals and accessions but also reflect the inherent variation and genetic relationships among collection holdings. We have examined the applicability of the random amplified polymorphic DNA (RAPD) assay for quick, cost-effective, and reliable use in addressing these needs in relation to collection organization and management. Twenty-five decamer oligonucleotide primers were screened individually with a test array composed of individuals representing a range of genetic relationships in Brassica oleracea L. (vegetable and forage cole crops). Over 140 reproducible, polymorphic fragments were generated for study. Each individual of the test array exhibited a unique molecular genotype and composites specific for accessions and botanical varieties could be established. An analysis of similarity based on amplified DNA fragments reflected the known genetic relationships among the selected entries. These results demonstrated that RAPD markers can be of great value in gene bank management for purposes of identification, measurement of variation, and establishment of genetic similarity at the intraspecific level.     

Group composition in wild and commensal hamadryas baboons: A comparative study in Saudi Arabia

Papio hamadryas was surveyed throughout its range in Saudi Arabia and was observed at altitudes ranging from 0 to 2300 m. Wild populations occur along the whole range of altitude, while commensal populations are only found above 850 m altitude. No variation in group size was found with altitude. Comparison of wild and commensal populations showed the following. (1) Their composition in terms of age and sex classes, overall adult sex ratios, and group size does not significantly differ. (2) Groups of both populations include, in similar proportions, three types of parties: one-male units (>70%), two-male units (>13%), and a few other units of variable composition. (3) The mean size of commensal parties is significantly larger than in the wild population; specifically one-male units are larger in the commensal population due to a larger number of females per male. Thus, female distribution in commensal groups is more inequitable than that in wild groups. (4) Finally, the number of females included in two-male units increases with altitude. These differences are discussed in terms of food availability and predator pressure and are compared with results obtained on other Arabian and Ethiopian populations.