Synthesis of enantiomerically pure isotopomers of 2-phenylpropionic acids

A series of enantiomerically pure [D,(13)C]-labeled isotopomeric 2-phenylpropionic acids were efficiently synthesized using a diastereoselective alkylation and kinetic resolution strategy.     

Pd-catalyzed asymmetric allylic alkylation using furanoside diphosphinite ligands

We have tested furanoside diphosphinite ligands 7 and 8, derived from inexpensive d-(+)-xylose, in the Pd-catalyzed allylic alkylation of two substrates with different steric properties. Enantiomeric excesses of up to 31% with good activities were obtained in the Pd-catalyzed allylic alkylation of substrate rac-1,3-diphenyl-3-acetoxyprop-1-ene 9 with dimethylmalonate as nucleophile. Our results show that the absolute configuration at carbon C-3 of the carbohydrate backbone controlled the sense of enantioselectivity. Models for asymmetric induction are discussed based on the absolute stereochemistry of the product.     

Immunoprecipitation of an Affinity-Alkylated Fragment of the Muscarinic Acetylcholine Receptor with an Anti-Ligand Monoclonal Antibody

A monoclonal antibody raised against the muscarinic acetylcholine affinity-alkylating antagonist propylbenzilylcholine mustard was tested for its ability to recognize affinity-alkylated muscarinic receptors. We demonstrate here that although the antibody will not recognize the mustard when it is covalently linked to the native muscarinic receptor, trypsinization of affinity-labeled membranes releases a proteolytic labeled fragment that can be specifically immunoprecipitated by the antibody. Electrophoretic analysis of the immunoprecipitate indicates that the ligand was associated with a polypeptide of molecular weight 5,000. The recognition of this fragment by the antibody provides a means to immunopurify a portion of the muscarinic receptor that is at or near the ligand binding site.     

Efficient one‐pot synthesis of N‐ethyl amino acids

Mono‐N‐ethylated α‐amino acid esters are obtained in high yields using reductive amination procedures. Formation of imine is achieved by excess of acetaldehyde, followed by removal of acetaldehyde and reduction by NaBH(OAc)₃. The elaborated one‐pot synthesis allows for the efficient synthesis of side‐chain protected amino acid derivatives. Copyright © 1999 European Peptide Society and John Wiley & Sons, Ltd.     

Novel nonclassical inhibitors of glycinamide ribonucleotide formyltransferase: 10-Formyl and 10-hydroxymethyl derivatives of 5,8,10-trideazapteroic acid

Several new 10-formyl and 10-hydroxymethyl derivatives of 5,8,10-trideazapteroic acid have been synthesized by a novel and convenient enamine alkylation procedure. Two of these compounds (10a and 10b) were shown to be very powerful inhibitors of L. casei (10a, IC₅₀ = 8 × 10⁻⁶ M ; 10b, IC₅₀ = 7 × 10⁻⁶ M ) and recombinant mouse (10a, IC₅₀ = 3.4 × 10⁻⁵ M ; 10b, IC₅₀ = 2.8 × 10⁻⁵ M ) glycinamide ribonucleotide formyltransferase (GARFT). These IC₅₀ values are comparable to the classical GARFT inhibitor (6R)-DDATHF (IC₅₀, L. casei 2.3 × 10⁻⁶M ; recombinant mouse 2.3 × 10⁻⁵ M ) under identical assay conditions. For both compounds, the inhibition of L. casei GARFT increased with time of incubation, but not markedly with the recombinant mouse enzyme. Due to their potential ability to interfere with purine biosynthesis and to penetrate microbial cells the new nonclassical GARFT inhibitors reported here may be useful for the treatment of infections caused by microorganisms that are sensitive and resistant to conventional antimicrobial agents.     

Reactive derivatives of oligonucleotide phosphorothioate analogues: IV. Site-directed modification of nucleic acids and intramolecular alkylation of phosphorothioate groups

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH₃)CH₂(RCl)(II-PS) and (RCl)CH₂N(CH₃)pGpsCpsAps TpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl=C₆H₄N(CH₃)(CH₂CH₂Cl) at the 3′- or 5′-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (att→∞) at 20°C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH₃)CH₂(RCl)(II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex. For Part III, see [1].     

Aberrant RNA methylation triggers recruitment of an alkylation repair complex

1. Download : Download high-res image (105KB)
2. Download : Download full-size image

     

DNA sequence dependence of guanine-O6 alkylation by the N-nitroso carcinogens N-methyl- and N-ethyl-N-nitrosourea

After intracellular in vitro exposure to the mutagenic and carcinogenic N-nitroso compounds N-methyl-N-nitrosourea (MeNU) or N-ethyl-N-nitrosourea (EtNU), respectively, the average relative amounts of the premutational lesion O⁶-alkylguanine represent about 6% and 8% of all alkylation products formed in genomic DNA. At the level of individual DNA molecules gunine-O⁶ alkylation does nor occur at random; rather, the probability of a substitution reaction at the nucleophilic O⁶ atom is influenced by nucleotide sequence, DNA conformation, and chromatin structure. In the present study, 5 different double-stranded polydeoxynucleotides and 15 double-stranded oligodeoxynucleotides (24-mers) were reacted with MeNU or EtNU in vitro under standardized conditions. Using a competitive radioimmunoassay in conjunction with an anti-(O⁶-2′-deoxyguanosine) monoclonal antibody, the frequency of guanine-O⁶ alkylation was found to be strongly dependent on the nature of the nucleotides flanking guanine on the 5 and 3′ sides. Thus, a 5′ neighboring guanine, followed by 5 adenine and 5′ cytosine, provided an up to 10-fold more ‘permissive’ condition for O⁶-alkylation of the central guanine than a 5′ thymine (with a 5-methylcytocine in the 5′ position being only slightly less inhibitory). Thymine and cytosine were more ‘permissive’ when placed 3′ in comparison with their affects in the 5′ flanking position.