Biphasic effect of extra-reticular Mg2+ on hepatic G6P transport and hydrolysis

Magnesium ions (Mg²⁺) play a key role in regulating hepatic cellular functions and enzymatic activities. In the present study, we report a concentration-dependent effect of cytosolic Mg²⁺ on G6P and pyrophosphate (PPi) transport and hydrolysis in digitonin-permeabilized rat hepatocytes. The stimulatory effect of Mg²⁺ on G6P is specific but biphasic, with a maximal effect at a concentration of 0.25 mM, whereas the effect on PPi increases in a dose-dependent manner. Both effects can be abolished by addition of EDTA to the system. Addition of taurocholate, histone-2A, alamethicin or A23187 to the incubation system results in a marked decrease in the Mg²⁺ concentration present within the endoplasmic reticulum lumen. Under these conditions, the stimulatory effect of extra-reticular Mg²⁺ on G6P transport and hydrolysis is abolished. Taken together, these data suggest that cytosolic Mg²⁺ stimulates G6P transport by acting at the level of the substrate binding site of the G6Pase enzymatic complex or the surrounding phospholipid environment. The effect, which is lost when G6P has readily access to the ER lumen, requires physiological endoplasmic reticulum Mg²⁺ content.     

Identification of a 20-bp regulatory element of the <Emphasis Type="Italic">Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase α2</Emphasis> gene that is essential for expression

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPalpha genes were analyzed using transgenic plants containing a promoter::ss-glucuronidase (GUS) fusion construct. Whereas the AtPFPalpha1 promoter was found to be ubiquitously active in all tissues, the AtPFPalpha2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPalpha2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPalpha2 and which is essential for AtPFPalpha2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFPalpha2 is sufficient for normal AtPFPalpha2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPalpha2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.     

Evaluation of peat decomposition by reflectivity

Summary We determined the degree of peat decomposition by measuring the reflectivity of near red rays (λ=650 nm) on 194 Sphagnum peat samples. This technique was simple, fast, inexpensive and reliable. The percentage reflectivity was highly correlated with the concentration of soluble humic substances (r=0.88), and with the maximum water holding capacity (r=0.92). Thus, the measure of reflectivity can be used advantageously to evaluate the degree of decomposition of Sphagnum peat related to its horticultural potential as growing medium.     

Proposed Carrier Lipid-binding Site of Undecaprenyl Pyrophosphate Phosphatase from Escherichia coli

Undecaprenyl pyrophosphate phosphatase (UppP), an integral membrane protein, catalyzes the dephosphorylation of undecaprenyl pyrophosphate to undecaprenyl phosphate, which is an essential carrier lipid in the bacterial cell wall synthesis. Sequence alignment reveals two consensus regions, containing glutamate-rich (E/Q)XXXE plus PGXSRSXXT motifs and a histidine residue, specific to the bacterial UppP enzymes. The predicted topological model suggests that both of these regions are localized near the aqueous interface of UppP and face the periplasm, implicating that its enzymatic function is on the outer side of the plasma membrane. The mutagenesis analysis demonstrates that most of the mutations (E17A/E21A, H30A, S173A, R174A, and T178A) within the consensus regions are completely inactive, indicating that the catalytic site of UppP is constituted by these two regions. Enzymatic analysis also shows an absolute requirement of magnesium or calcium ions in enzyme activity. The three-dimensional structural model and molecular dynamics simulation studies have shown a plausible structure of the catalytic site of UppP and thus provides insights into the molecular basis of the enzyme-substrate interaction in membrane bilayers.     

Sucrose is metabolised by sucrose synthase and glycolysis within the phloem complex of Ricinus communis L. seedlings

Metabolites and enzyme activities were measured in the phloem sap exuding from a cut hypocotyl of germinating castor-bean (Ricinus communis L.) seedlings. The sap contained considerable quantities of adenine nucleotides, uridine nucleotides, uridine diphosphoglucose (UDPGlc), all the major phosphorylated metabolites required for glycolysis, fructose-2,6-bisphosphate and pyrophosphate. Supplying 200 mM glucose instead of sucrose to the cotyledons resulted in high concentrations of glucose in the sap, but did not modify the metabolite levels. In contrast, when 200 mM fructose was supplied we found only a low level of fructose but a raised sucrose concentration in the sap, which was accompanied by a three-to fourfold decrease of UDPGlc, and an increase of pyrophosphate, UDP and UTP. The measured levels of metabolites are used to estimate the molar mass action ratios and in-vivo free-energy change associated with the various reactions of sucrose breakdown and glycolysis in the phloem. It is concluded that the reactions catalysed by ATP-dependent phosphofructokinase and pyruvate kinase are removed from equilibrium in the phloem, whereas the reactions catalysed by sucrose synthase, UDPGlc-pyrophosphorylase, phosphoglucose mutase, phosphoglucose isomerase, aldolase, triose-phosphate isomerase, phosphoglycerate mutase and enolase are close to equilibrium within the conducting elements of the phloem. Since the exuded sap contained negligible or undetectable activities of the enzymes, it is concluded, that the responsible proteins are bound, or sequesterd behind plasmodesmata, possibly in the companion cells. It is argued that sucrose mobilisation via a reversible reaction catalysed by sucrose synthase is particularily well suited to allow the rate of sucrose breakdown in the phloem to respond to changes in the metabolic requirement for ATP, and for UDPGlc during callose production. It is also calculated that the transport of nucleotides in the phloem sap implies that there must be a very considerable uptake or de-novo biosynthesis of these cofactors in the phloem.     

Nuclear magnetic resonance-based quantification of organic diphosphates

Phosphorylated compounds are ubiquitous in life. Given their central role, many such substrates and analogs have been prepared for subsequent evaluation. Prior to biological experiments, it is typically necessary to determine the concentration of the target molecule in solution. Here we describe a method where concentrations of stock solutions of organic diphosphates and bisphosphonates are quantified using ³¹P nuclear magnetic resonance (NMR) spectroscopy with standard instrumentation using a capillary tube with a secondary standard. The method is specific and is applicable down to a concentration of 200 μM. The capillary tube provides the reference peak for quantification and deuterated solvent for locking.     

Direct chemiluminescence detection of nitric oxide in aqueous solutions using the natural nitric oxide target soluble guanylyl cyclase

Nitric oxide (NO) is a free radical involved in many physiological processes including regulation of blood pressure, immune response, and neurotransmission. However, the measurement of extremely low, in some cases subnanomolar, physiological concentrations of nitric oxide presents an analytical challenge. The purpose of this methods article is to introduce a new highly sensitive chemiluminescence approach to direct NO detection in aqueous solutions using a natural nitric oxide target, soluble guanylyl cyclase (sGC), which catalyzes the conversion of guanosine triphosphate to guanosine 3′,5′-cyclic monophosphate and inorganic pyrophosphate. The suggested enzymatic assay uses the fact that the rate of the reaction increases by about 200 times when NO binds with sGC and, in so doing, provides a sensor for nitric oxide. Luminescence detection of the above reaction is accomplished by converting inorganic pyrophosphate into ATP with the help of ATP sulfurylase followed by light emission from the ATP-dependent luciferin–luciferase reaction. Detailed protocols for NO quantification in aqueous samples are provided. The examples of applications include measurement of NO generated by a nitric oxide donor (PAPA-NONOate), nitric oxide synthase, and NO gas dissolved in buffer. The method allows for the measurement of NO concentrations in the nanomolar range and NO generation rates as low as 100 pM/min.     

Subcellular pyrophosphate metabolism in developing tubers of potato (Solanum tuberosum)

PPi has previously been implicated specifically in the co-ordination of the sucrose–starch transition and in the broader context of its role as co-factor in heterotrophic plant metabolism. In order to assess the compartmentation of pyrophosphate (PPi) metabolism in the potato tuber we analysed the effect of expressing a bacterial pyrophosphatase in the amyloplast of wild type tubers or in the cytosol or amyloplast of invertase-expressing tubers. The second and third approaches were adopted since we have previously characterized the invertase expressing lines to both exhibit highly altered sucrose metabolism and to contain elevated levels of PPi (Farré et al. (2000a) Plant Physiol 123:681) and therefore this background rendered questions concerning the level of communication between the plastidic and cytosolic pyrophosphate pools relatively facile. In this study we observed that the increase in PPi in the invertase expressing lines was mainly confined to the cytosol. Accordingly, the expression of a bacterial pyrophosphatase in the plastid of either wild type or invertase-expressing tubers did not lead to a decrease in total PPi content. However, the expression of the heterologous pyrophosphatase in␣the cytosol of cytosolic invertase-expressing tubers led to strong metabolic changes. These results are discussed both with respect to our previous hypotheses and to current models of the compartmentation of potato tuber metabolism.     

Formation of pyrophosphate,tripolyphosphate, and phosphorylimidazole with the thioester,N, S-diacetylcysteamine,as the condensing agent

Summary Reaction of 0.20M orthophosphate with 0.20M N,S-diacetylcysteamine in 0.40M imidazole at pH 7.0 or 8.0 under drying conditions at 50°C for 6 days yields pyrophosphate and tripolyphosphate in the presence and absence of 0.10M divalent metal ion. The efficiency of utilization of N,S-diacetylcysteamine in the formation of pyrophosphate linkages ranges from 3 – 8% under the above conditions. The thioester, N,S-diacetylcysteamine, and imidazole are required for phosphoanhydride formation.Reaction of 0.40M orthophosphate with 0.20M N, S-diacetylcysteamine in 0.40M imidazole at ambient temperature for 6 days yields phosphorylimidazole in the absence or presence of 0.05M MgCl₂. Phosphorylimidazole and pyrophosphate are formed in the presence of 0.05M CaCl₂; pyrophosphate and tripolyphosphate are formed with 0.15M CaCl₂. The efficiency of utilization of N,S-diacetylcysteamine in the formation of pyrophosphate linkages is roughly 7% at 6 days of reaction with 0.15M CaCl₂. The thioester, N,S-diacetylcysteamine and imidazole are required for the formation of phosphoanhydrides. The significance of these reactions to molecular evolution is discussed.Abbreviations P₁ orthophosphate - P₂ pyrophosphate - P₃ tripolyphosphate - ImP phosphorylimidazole - Ac-Csa(Ac) N, S-diacetylcysteamine - Im imidazole