Protein interactions in the calf eye lens: interactions between β-crystallins are repulsive whereas in γ-crystallins they are attractive

Non-specific interactions in beta- and gamma-crystallins have been studied by solution X-ray scattering and osmotic pressure experiments. Measurements were carried out as a function of protein concentration at two ionic strengths. The effect of temperature was tested between 7 degrees C and 31 degrees C. Two types of interactions were observed. With beta-crystallin solutions, a repulsive coulombic interaction could be inferred from the decrease of the normalized X-ray scattering intensity near the origin with increasing protein concentration and from the fact that the osmotic pressure increases much more rapidly than in the ideal case. As was previously observed with alpha-crystallins, such behaviour is dependent upon ionic strength but is hardly affected by temperature. In contrast, with gamma-crystallin solutions, the normalized X-ray scattering intensity near the origin increases with increasing protein concentration and the osmotic pressure increases less rapidly than in the ideal case. Such behaviour indicates that attractive forces are predominant, although we do not yet know their molecular origin. Under our experimental conditions, the effect of temperature was striking whereas no obvious contribution of the ionic strength could be seen, perhaps owing to masking by the large temperature effect. The relevance of the different types of non-specific interactions for lens function is discussed.     

Effect of “restricted ovulator” gene on uptake of yolk-precursor protein

Summary The bulk of the yolk proteins and lipoproteins constituting the yolks of mature oocytes in birds are synthesized by the liver and transported via the plasma to the oocytes where they are incorporated by micropinocytosis. Evidence is presented indicating that oocytes of hens possessing a mutation identified by Jones, Briles, and Schjeide as a restricted ovulator gene fail to incorporate normal amounts and proportions of low density lipoproteins, lipovitellin and possibly other proteins making up the bulk of the yolk material. Plasma albumin is taken into the yolks but the other proteins synthesized by the liver for deposition within the oocytes accumulate in the plasma, attaining very high levels. The possible nature of the lock preventing normal deposition of the excluded yolk proteins is discussed.     

Activities of Glucose-6-phosphate, 6-phosphogluconate,and Isocitrate Dehydrogenases from Leishmania donovani Cultivated at 25 and 37 C*

SYNOPSIS. The activities of glucose-6-phosphate dehydrogenase (G-6-PD) (EC No. 1.1.1.49), 6-phosphogluconate dehydrogenase (PGD) (EC No. 1.1.1.44), and isocitrate dehydrogenase (ICD) (EC No. 1.1.1.42) from promastigotes of Leishmania donovani strain 3S grown at 25 C in modified Tobie's (mT) medium and from promastigotes of the 37 C-adapted substrain of this strain cultivated in the mT at 37 C were assayed at 25 and 37 C. At 25 C ICD from both the strain and the substrain had the highest, and PGD, the lowest activity; the activity of G-6-PD was intermediate, but much closer to that of ICD. Irrespective of the temperature of the assay, the activities of G-6-PD and ICD from the 37 C substrain were significantly higher than those of these enzymes from the parental strain; however, the activity of PGD from the 25 C strain was slightly higher than that of this dehydrogenase from the 37 C-adapted stock. No significant activity losses of G-6-PD and ICD from either the strain or the substrain were noted after incubation of the extracts in the presence of 0.25 M sucrose at 37 C for 2 hr. PGD was unstable in such extracts, but it could be rendered stable by the addition of 4 mM 6-phosphogluconate. G-6-PD was the least and ICD the most dependent on Mg²⁺ ions. In the 15–25 C range, the Q₁₀ values of the enzymes from the 25 C strain were 2.83, 2.5, and 2.63 for G-6-PD, PGD, and ICD, respectively. These values for the respective enzymes in the 25–35 C range were 2.06, 1.67, and 1.62. The Q₁₀ values of the enzymes from the 37 C substrain in the 15–25 C range were 2.06 for G-6-PD, 3.25 for PGD, and 2.77 for ICD; in the 25–35 C range, the corresponding values were 1.67, 1.46, and 1.83. Cultivation of the 37 C substrain at 25 C was accompanied by a drop in G-6-PD and ICD activities.     

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.     

LL-37 and its analog FF/CAP18 attenuate neutrophil migration in sepsis-induced acute lung injury

Introduction: Sepsis can result in acute lung injury. LL-37 is a small cationic host defense peptide involved in anti-inflammatory. In the current study, it was hypothesized that antimicrobial peptide LL-37 could play a protective role in attenuating the progression of sepsis-induced acute lung injury. Methods: Forty male C57BL/6 mice were induced into sepsis using cecal ligation and puncture, and subsequently administered with recombinant mouse osteopontin. Peptides LL-37, the LL-37 analog (FF/CAP18, called sLL-37), or normal saline was intravenously administered into septic mice for 20 hours. Then, proinflammatory cytokines (IL-6 and IL-1β), acute lung injury markers (alanine aminotransferase [ALT], aspartate aminotransferase [AST], and lactate dehydrogenase [LDH]), the neutrophil infiltration marker (myeloperoxidase [MPO]), and neutrophil infiltration were detected. Furthermore, the neutrophil migration and expression of migration-related factors (focal adhesion kinase [FAK], ERK, and P38) in differentiated HL-60 cells were detected. Results: Septic mice had upregulated IL-6, IL-1β, ALT, AST, LDH, MPO, p-FAK, p-ERK, and p-P38, infiltrated neutrophils, and migrated neutrophil-like HL-60 cells. In contrast, the administration of peptide LL-37 and sLL-37 inhibited all these changes. Compared with septic mice, it was found that proinflammatory cytokines, lung injury markers, MPO, and infiltrated neutrophils decreased in mice treated with LL-37 and sLL-37. In addition, the migrated neutrophil-like HL-60 cells and activated p-FAK, p-ERK, and p-P38 proteins were suppressed by LL-37 and sLL-37 treatments. Conclusions: Peptide LL-37 and its analog sLL-37 attenuated the progression of sepsis-induced acute lung injury by inhibiting neutrophil infiltration and migration through the FAK, ERK, and P38 pathways.     

Polyphosphoinositide synthesis in rabbit erythrocyte membranes

Incubation of rabbit erythrocyte ghosts at 25 °C with 1 mm [γ-³²P]ATP and MgCl₂ results in incorporation of ³²P into diphosphoinositide and triphosphoinositide with initial rates of 15.6 and 1.8 nmol ³²P/mg/h, respectively. Incorporation of ³²P into diphosphoinositide plateaus after 20 min whereas incorporation into triphosphoinositide did not plateau until after 80 min. Diphosphoinositide and triphosphoinositide, prelabeled with ³²P, did not undergo significant breakdown when incubated at 25 °C for 15 to 20 min. Turnover of ³²P-labeled diphosphoinositide and triphosphoinositide was insignificant in the presence of MgCl₂ and cold ATP. Diphosphoinositide is not phosphorylated to triphosphoinositide in the presence of Mg-ATP under conditions in which synthesis of these polyphosphoinositides can occur. In the presence of neomycin and Mg-ATP, labeled diphosphoinositide was rapidly phosphorylated to triphosphoinositide. Neomycin had no effect on labeled di- and triphosphoinositide content in the absence of ATP. Freeze-thawing the ghosts or the addition of Triton X-100 does not produce the same effect as neomycin. The results of this investigation suggest that diphosphoinositide and triphosphoinositide are normally synthesized from endogenous phosphatidylinositol in rabbit ghosts by separate enzymatic pathways. Neomycin an aminoglycoside which interacts with polyphosphoinositides may perturb the organization of substrates and kinase activities involved in polyphosphoinositide metabolism and alter these pathways.     

A Cl and Cl NMR study of chloride binding to the erythrocyte anion transport protein

Band 3, the erythrocyte anion transport protein, mediates the one-for-one exchange of bicarbonate and chloride ions across the membrane and consequently plays an important role in respiration. Binding to the protein forms the first step in the translocation of the chloride across the membrane. ³⁵Cl and ³⁷Cl NMR relaxation measurements at various field strengths were used to study chloride binding to the protein in the presence and absence of the transport inhibitor 4,4′-dinitrostilbene-2,2′-disulfonate. Significant differences occurred in the NMR relaxation rates depending on whether the inhibitor was present or not. The results indicate that the rate of chloride association and dissociation at each external binding site occurs on a time scale of 5 μs. This implies that the transmembrane flux is not limited by the rate of chloride binding to the external chloride binding site of band 3. The rotational correlation-time of chloride bound to band 3 was found to be 20 ns with a quadrupole coupling constant of 3 MHz.     

Effect of finishing period length with α-tocopherol supplementation on the expression of vitamin E-related genes in the muscle and subcutaneous fat of light lambs

The aim of this study was to investigate how different finishing period lengths with α-tocopherol supplementation or alfalfa grazing affect mRNA expression levels of genes related to vitamin E metabolism in L. thoracis (LT) muscle and subcutaneous fat (SF) from lambs of the Rasa Aragonesa breed. Indoors, concentrate-fed light lambs (n = 48) were supplemented with 500 dl-α-tocopheryl acetate/kg concentrate for an average finishing period length of 0 (C), 10.7 (VE10d), 21.2 (VE20d) and, 32.3 (VE30d) days before slaughtering. Simultaneously, 8 lambs with their dams were alfalfa-grazed. The α-tocopherol affected in a short-term the expression of genes in LT muscle (ABCA1, LPL, APOE, and SREBP1) and SF (ABCA1, SCARB1, LPL, and PPARG). On the contrary, PPARA gene expression showed a long-term α-tocopherol effect because the highest levels of PPARA mRNA were found in the VE30d.