Evaluation of the potential of various aquatic eco-systems in harnessing bioelectricity through benthic fuel cell: Effect of electrode assembly and water characteristics

Six different types of ecological water bodies were evaluated to assess their potential to generate bioelectricity using benthic type fuel cell assemblies. Experiments were designed with various combinations of electrode assemblies, surface area of anode and anodic materials. Among the 32 experiments conducted, nine combinations evidenced stable electron-discharge/current. Nature, flow conditions and characteristics of water bodies showed significant influence on the power generation apart from electrode assemblies, surface area of anode and anodic material. Stagnant water bodies showed comparatively higher power output than the running water bodies. Placement of cathode on algal mat (as bio-cathode) documented several folds increment in power output. Electron-discharge started at 1000 Ω resistance in polluted water bodies (Nacaharam cheruvu, Hussain Sagar lake Musi river), whereas, in relatively less polluted water bodies (Uppal pond/stream, Godavari river) electron-discharge was observed at low resistances (500/750 Ω).     

Soluble ST2 Levels Are Associated with Bleeding in Patients with Severe Leptospirosis

Background

Severe leptospirosis features bleeding and multi-organ failure, leading to shock and death. Currently it is assumed that both exaggerated inflammation and immune suppression contribute to mortality in sepsis. Indeed, several proinflammatory cytokines are reported to be induced during leptospirosis. Toll-like receptors, which play an important role in the initiation of an innate immune response, are inhibited by negative regulators including the membrane-bound ST2 (mST2) receptor. Soluble ST2 (sST2) has been implicated to inhibit signaling through mST2. The aim of this study was to determine the extent of sST2 and (pro-) inflammatory cytokine release in patients with severe leptospirosis.

Methodology and Principal Findings

In an observational study, 68 consecutive cases of severe leptospirosis were included. Soluble ST2 and cytokines (TNF-α, IL-1β, IL-6, IL-8, and IL-10) were repeatedly measured. To determine whether blood cells are a source of sST2 during infection, we undertook an in vitro experiment: human whole blood and peripheral blood mononuclear cells (PBMC) were stimulated with viable pathogenic Leptospira. All patients showed elevated sST2, IL-6, IL-8, and IL-10 levels on admission. Admission sST2 levels correlated with IL-6, IL-8, and IL-10. Thirty-four patients (50%) showed clinical bleeding. Soluble ST2 levels were significantly associated with bleeding overall (OR 2.0; 95%CI: 1.2–3.6) and severe bleeding (OR 5.1; 95%CI: 1.1–23.8). This association was unique, since none of the cytokines showed this correlation. Moreover, sST2 was associated with mortality (OR 2.4; 95%CI: 1.0–5.8). When either whole blood or isolated PBMCs were stimulated with Leptospira in vitro, no sST2 production could be detected.

Conclusions

Patients with severe leptospirosis demonstrated elevated plasma sST2 levels. Soluble ST2 levels were associated with bleeding and mortality. In vitro experiments showed that (white) blood cells are probably not the source. In this regard, sST2 could be an indicative marker for tissue damage in patients suffering from severe leptospirosis.     

URP‐based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.     

Temperature tolerance and energetics: a dynamic energy budget-based comparison of North Atlantic marine species

Temperature tolerance and sensitivity were examined for some North Atlantic marine species and linked to their energetics in terms of species-specific parameters described by dynamic energy budget (DEB) theory. There was a general lack of basic information on temperature tolerance and sensitivity for many species. Available data indicated that the ranges in tolerable temperatures were positively related to optimal growth temperatures. However, no clear relationships with temperature sensitivity were established and no clear differences between pelagic and demersal species were observed. The analysis was complicated by the fact that for pelagic species, experimental data were completely absent and even for well-studied species, information was incomplete and sometimes contradictory. Nevertheless, differences in life-history strategies were clearly reflected in parameter differences between related species. Two approaches were used in the estimation of DEB parameters: one based on the assumption that reserve hardly contributes to physical volume; the other does not make this assumption, but relies on body-size scaling relationships, using parameter values of a generalized animal as pseudo-data. Temperature tolerance and sensitivity seemed to be linked with the energetics of a species. In terms of growth, relatively high temperature optima, sensitivity and/or tolerance were related to lower relative assimilation rates as well as lower maintenance costs. Making the step from limited observations to underlying mechanisms is complicated and extrapolations should be carefully interpreted. Special attention should be devoted to the estimation of parameters using body-size scaling relationships predicted by the DEB theory.     

Dietary Protein and Blood Pressure: A Systematic Review

Background

Elevated blood pressure (BP), which is a major risk factor for cardiovascular disease, is highly prevalent worldwide. Recently, interest has grown in the role of dietary protein in human BP. We performed a systematic review of all published scientific literature on dietary protein, including protein from various sources, in relation to human BP.

Methodology/Principal Findings

We performed a MEDLINE search and a manual search to identify English language studies on the association between protein and blood pressure, published before June 2010. A total of 46 papers met the inclusion criteria. Most observational studies showed no association or an inverse association between total dietary protein and BP or incident hypertension. Results of biomarker studies and randomized controlled trials indicated a beneficial effect of protein on BP. This beneficial effect may be mainly driven by plant protein, according to results in observational studies. Data on protein from specific sources (e.g. from fish, dairy, grain, soy, and nut) were scarce. There was some evidence that BP in people with elevated BP and/or older age could be more sensitive to dietary protein.

Conclusions/Significance

In conclusion, evidence suggests a small beneficial effect of protein on BP, especially for plant protein. A blood pressure lowering effect of protein may have important public health implications. However, this warrants further investigation in randomized controlled trials. Furthermore, more data are needed on protein from specific sources in relation to BP, and on the protein-BP relation in population subgroups.     

A comparison of univariate and multivariate gene selection techniques for classification of cancer datasets

Background  

Gene selection is an important step when building predictors of disease state based on gene expression data. Gene selection generally improves performance and identifies a relevant subset of genes. Many univariate and multivariate gene selection approaches have been proposed. Frequently the claim is made that genes are co-regulated (due to pathway dependencies) and that multivariate approaches are therefore per definition more desirable than univariate selection approaches. Based on the published performances of all these approaches a fair comparison of the available results can not be made. This mainly stems from two factors. First, the results are often biased, since the validation set is in one way or another involved in training the predictor, resulting in optimistically biased performance estimates. Second, the published results are often based on a small number of relatively simple datasets. Consequently no generally applicable conclusions can be drawn.     

Lung cancer after treatment for Hodgkin's disease: focus on radiation effects

Aspects of radiation-induced lung cancer were evaluated in an international study of Hodgkin's disease. The study population consisted of 227 patients with lung cancer and 455 matched controls. Unique features included dose determinations to the specific location in the lung where each cancer developed and quantitative data on both chemotherapy and tobacco use obtained from medical records. The estimated excess relative risk (ERR) per Gy was 0.15 (95% CI: 0.06-0.39), and there was little evidence of departure from linearity even though lung doses for the majority of Hodgkin's disease patients treated with radiotherapy exceeded 30 Gy. The interaction of radiation and chemotherapy that included alkylating agents was almost exactly additive, and a multiplicative relationship could be rejected (P = 0.017). Conversely, the interaction of radiation and smoking was consistent with a multiplicative relationship, but not with an additive relationship (P < 0.001). The ERR/Gy for males was about four times that for females, although the difference was not statistically significant. There was little evidence of modification of the ERR/Gy by time since exposure (after a 5-year minimum latent period), age at exposure, or attained age. Because of the very high radiation doses received by Hodgkin's disease patients and the immunodeficiency inherent to this lymphoma and that associated with chemotherapy, generalizing these findings to other populations receiving considerably lower doses of radiation should be done cautiously.     

Effect of long-term culture of a human laryngeal carcinoma cell line on epitectin production and tumorigenicity in athymic mice

Epitectin is a high molecular weight mucin-type glycoprotein over-expressed on the surface of human carcinoma cells. In cancer cells, it is proposed to play a protective function and to modulate cell surface properties such as antigenicity and cell adhesion. We have examined the effect of long-term culture on the cell curface expression of epitectin by a human laryngeal carcinoma cell line and the correlation between epitectin expression and tumor production in athymic mice. Indirect immunofluorescence labelling using an epitectin specific monoclonal antibody showed that the level of epitectin on the cell surface was significantly reduced after 78 or more generations in culture. Gel electrophoresis of cell extracts, followed by wheat germ agglutinin and peanut agglutinin overlay analyses, demonstrated similar losses in total cellular epitectin as a result of prolonged passage in culture. The levels of other glycoproteins reacting with wheat germ agglutinin were not significantly altered in high passage cells. Similar results were obtained when HMFG-2 monoclonal antibody was used to probe the levels of cell surface epitectin. In contrast to the above probes, the binding of HMFG-2 to epitectin is independent of glycosylation, therefore it can be concluded that the observed changes are not due to aberration in epitectin glycosylation with increasing passage number but rather due to lack of synthesis of epitectin. The ability of the low epitectin producing H.Ep.2 cells to grow as tumors in athymic mice was reduced compared to the high epitectin producing cells.This work comprises part of a doctoral thesis by N.A.D. submitted to the Pennsylvania State University.