Molecular diversity and genetic variability of kernel tocopherols among maize inbreds possessing favourable haplotypes of γ-tocopherol methyl transferase (ZmVTE4)

Journal of Plant Biochemistry and Biotechnology - Vitamin E deficiency is a serious health concern in humans. Biofortification of maize kernel with high vitamin E (α-tocopherol) provides...     

Butanol production from wheat straw hydrolysate using <Emphasis Type="Italic">Clostridium beijerinckii</Emphasis>

In these studies, butanol (acetone butanol ethanol or ABE) was produced from wheat straw hydrolysate (WSH) in batch cultures using Clostridium beijerinckii P260. In control fermentation 48.9 g L⁻¹ glucose (initial sugar 62.0 g L⁻¹) was used to produce 20.1 g L⁻¹ ABE with a productivity and yield of 0.28 g L⁻¹ h⁻¹ and 0.41, respectively. In a similar experiment where WSH (60.2 g L⁻¹ total sugars obtained from hydrolysis of 86 g L⁻¹ wheat straw) was used, the culture produced 25.0 g L⁻¹ ABE with a productivity and yield of 0.60 g L⁻¹ h⁻¹ and 0.42, respectively. These results are superior to the control experiment and productivity was improved by 214%. When WSH was supplemented with 35 g L⁻¹ glucose, a reactor productivity was improved to 0.63 g L⁻¹ h⁻¹ with a yield of 0.42. In this case, ABE concentration in the broth was 28.2 g L⁻¹. When WSH was supplemented with 60 g L⁻¹ glucose, the resultant medium containing 128.3 g L⁻¹ sugars was successfully fermented (due to product removal) to produce 47.6 g L⁻¹ ABE, and the culture utilized all the sugars (glucose, xylose, arabinose, galactose, and mannose). These results demonstrate that C. beijerinckii P260 has excellent capacity to convert biomass derived sugars to solvents and can produce over 28 g L⁻¹ (in one case 41.7 g L⁻¹ from glucose) ABE from WSH. Medium containing 250 g L⁻¹ glucose resulted in no growth and no ABE production. Mixtures containing WSH + 140 g L⁻¹ glucose (total sugar approximately 200 g L⁻¹) showed poor growth and poor ABE production. Mention of trade names or commercial products in this article is solely for the purpose of providing scientific information and does not imply recommendation or endorsement by the United States Department of Agriculture.     

Microbial diversity and function in crystalline basement beneath the Deccan Traps explored in a 3 km borehole at Koyna,western India

Deep terrestrial subsurface represents a huge repository of global prokaryotic biomass. Given its vastness and importance, microbial life within the deep subsurface continental crust remains under-represented in global studies. We characterize the microbial communities of deep, extreme and oligotrophic realm hosted by crystalline Archaean granitic rocks underneath the Deccan Traps, through sampling via 3000 m deep scientific borehole at Koyna, India through metagenomics, amplicon sequencing and cultivation-based analyses. Gene sequences 16S rRNA (7.37 × 10⁶) show considerable bacterial diversity and the existence of a core microbiome (5724 operational taxonomic units conserved out of a total 118,064 OTUs) across the depths. Relative abundance of different taxa of core microbiome varies with depth in response to prevailing lithology and geochemistry. Co-occurrence network analysis and cultivation attempt to elucidate close interactions among autotrophic and organotrophic bacteria. Shotgun metagenomics reveals a major role of autotrophic carbon fixation via the Wood–Ljungdahl pathway and genes responsible for energy and carbon metabolism. Deeper analysis suggests the existence of an ‘acetate switch’, coordinating biosynthesis and cellular homeostasis. We conclude that the microbial life in the nutrient- and energy-limited deep granitic crust is constrained by the depth and managed by a few core members via a close interplay between autotrophy and organotrophy.     

DNA methylation regulates Microtubule-associated tumor suppressor 1 in human non-small cell lung carcinoma

Microtubule associated tumor suppressor 1 (MTUS1) has been recognized as a tumor suppressor gene in multiple cancers. However, the molecular mechanisms underlying the regulation of MTUS1 are yet to be investigated. This study aimed to clarify the significance of DNA methylation in silencing MTUS1 expression. We report that MTUS1 acts as tumor suppressor in non-small cell lung carcinoma (NSCLC). Analysis of in silico database and subsequent knockdown of DNMT1 suggested an inverse correlation between DNMT1 and MTUS1 function. Interestingly, increased methylation at MTUS1 promoter is associated with low expression of MTUS1. Treatment with DNA methyltransferases (DNMTs) inhibitor, 5-aza-2′-deoxycytidine (AZA) leads to both reduced promoter methylation accompanied with enrichment of H3K9Ac and enhanced MTUS1 expression. Remarkably, knockdown of MTUS1 showed increased proliferation and migration of NSCLC cells in contrast to diminished proliferation and migration, upon treatment with AZA. We concluded that low expression of MTUS1 correlates to DNA methylation and histone deacetylation in human NSCLC.     

Enhancement in Iron Absorption on Intake of Chemometrically Optimized Ratio of Probiotic Strain Lactobacillus plantarum 299v with Iron Supplement Pearl Millet

Biological Trace Element Research - This research article aims to establish the intake ratio of probiotic Lactobacillus plantarum 299v with iron supplement pearl millet by central composite design...     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Nod1-mediated lipolysis promotes diacylglycerol accumulation and successive inflammation via PKCδ-IRAK axis in adipocytes

Chronic inflammation contributes to obesity mediated metabolic disturbances, including insulin resistance. Obesity is associated with altered microbial load in metabolic tissues that can contribute to metabolic inflammation. Different bacterial components such as, LPS, peptidoglycans have been shown to underpin metabolic disturbances through interaction with host innate immune receptors. Activation of Nucleotide-binding oligomerization domain-containing protein 1 (Nod1) with specific peptidoglycan moieties promotes insulin resistance, inflammation and lipolysis in adipocytes. However, it was not clear how Nod1-mediated lipolysis and inflammation is linked. Here, we tested if Nod1-mediated lipolysis caused accumulation of lipid intermediates and promoted cell autonomous inflammation in adipocytes. We showed that Nod1-mediated lipolysis caused accumulation of diacylglycerol (DAG) and activation of PKCδ in 3T3-L1 adipocytes, which was prevented with a Nod1 inhibitor. Nod1-activated PKCδ caused downstream stimulation of IRAK1/4 and was associated with increased expression of proinflammatory cytokines such as, IL-1β, IL-18, IL-6, TNFα and MCP-1. Pharmacological inhibition or siRNA mediated knockdown of IRAK1/4 attenuated Nod1-mediated activation of NF-κB, JNK, and the expression of proinflammatory cytokines. These results reveal that Nod1-mediated lipolysis promoted accumulation of DAG, which engaged PKCδ and IRAK1/4 to augment inflammation in 3T3-L1 adipocytes.     

The first epidermal growth factor-like domain of the low-density lipoprotein receptor contains a noncanonical calcium binding site

Removal of cholesterol-containing particles from the circulation is mediated by the low-density lipoprotein (LDL) receptor. Upon ligand binding, the receptor-ligand complex is endocytosed, and the ligand is released. The important biological role of the LDL receptor (LDLR) has been highlighted by the identification of more than 400 LDLR mutations that are associated with familial hypercholesterolemia. The extracellular region of the LDLR is modular in nature and principally comprises multiple copies of ligand binding, epidermal growth factor-like (EGF), and YWTD-type domains. This report describes characterization of the calcium binding properties of the tandem pair of EGF domains. While only the C-terminal EGF module contains the consensus sequence associated with calcium binding, a noncanonical calcium binding site in the N-terminal domain has been revealed using solution NMR spectroscopy. The calcium dissociation constants for the N- and C-terminal sites have been measured under physiologically relevant pH and ionic strength conditions using a combination of solution NMR, intrinsic protein fluorescence, and chromophoric chelator methods to be approximately 50 microM and approximately 10-20 microM, respectively. Identification of the novel calcium binding motif in LDLR sequences from other species suggests that it may confer specificity within the LDLR gene family. Comparison of the K(d) for the C-terminal site with the calcium concentration in late vesicles indicates that the binding properties of this module may be tuned to titrate upon endocytosis of the LDL receptor-ligand complex, and thus calcium binding may play a role in the ligand dissociation process.