Molecular comparison of the negative-acting nitrogen control gene,nmr, inNeurospora crassa and otherNeurospora and fungal species

In Neurospora crassa, the expression of unlinked structural genes which encode nitrogen catabolic enzymes is subject to genetic and metabolic regulation. The negative-acting nmr regulatory gene appears to play a role in nitrogen catabolite repression. Using the N. crassa nmr gene as a probe, homologous sequences were identified in a variety of other filamentous fungi. The polymerase chain reaction was used to isolate the nmr-like gene from the exotic Mauriceville strain of N. crassa and from the two related species, N. intermedia and N. sitophila. Sequence comparisons were carried out with a 1.7-kb DNA segment which includes the entire coding region of nmr plus 5' and 3' noncoding sequences. The size of the nmr coding region was identical in all three Neurospora species. Approximately 30 nucleotide base substitutions were found in the coding region of the nmr gene of each of the sister species when compared to the standard N. crassa sequence. However, most of the base changes occurred in third codon positions and were silent. The NMR proteins of N. sitophila and of N. intermedia display only three and four amino acid substitutions, respectively, from the N. crassa protein. Two regions of high variability, which include deletions and insertions of bases, were found in the 5' and 3' noncoding regions of the gene.     

Fluorescence polarization and low-temperature absorption spectroscopy of a subunit form of light-harvesting complex I from purple photosynthetic bacteria

Measurements of polarized fluorescence and CD were made on light-harvesting complex 1 and a subunit form of this complex from Rhodospirillum rubrum, Rhodobacter sphaeroides, and Rhodobacter capsulatus. The subunit form of LH1, characterized by a near-infrared absorbance band at approximately 820 nm, was obtained by titration of carotenoid-depleted LH1 complexes with the detergent n-octyl beta-D-glucopyranoside as reported by Miller et al. (1987) [Miller J. F., Hinchigeri, S. B., Parkes-Loach, P. S., Callahan, P. M., Sprinkle, J. R., & Loach, P. A. (1987) Biochemistry 26, 5055-5062]. Fluorescence polarization and CD measurements at 77 K suggest that this subunit form must consist of an interacting bacteriochlorophyll a dimer in all three bacterial species. A small, local decrease in the polarization of the fluorescence is observed upon excitation at the blue side of the absorption band of the B820 subunit. This decrease is ascribed to the presence of a high-energy exciton component, perpendicular to the main low-energy exciton component. From the extent of the depolarization, we estimate the oscillator strength of the high-energy component to be at most 3% of the main absorption band. The optical properties of B820 are best explained by a Bchl a dimer that has a parallel or antiparallel configuration with an angle between the Qy transition dipoles not larger than 33 degrees. The importance of this structure is emphasized by the results showing that core antennas from three different purple bacteria have a similar structure.(ABSTRACT TRUNCATED AT 250 WORDS)     

Cloning and characterization of the carp prolactin gene

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.     

Lysyl oxidase-mediated crosslinking in granulation tissue collagen in two models of hyperglycemia.

Enzymatically mediated crosslinks and nonenzymatic glycation were quantified in granulation tissue collagen in two models of hyperglycemia, diabetes and galactosemia, that have opposite effects on collagen solubility. The effects of castration, which alters collagen solubility, was also investigated. Collagen from both diabetic and galactosemic rats had significantly increased levels of dihydroxylysinonorleucine (DHLNL), a difunctional reducible crosslink. Galactosemic rats had significantly decreased levels of hydroxypyridinium, a trifunctional product of DHLNL and hydroxylysine, relative to control values, while diabetic rats had normal levels. Values for all other detectable crosslinks in collagen from hyperglycemic rats were indistinguishable from control values. Nonenzymatic glycation was increased in both groups of hyperglycemic rats. In diabetic rats, but not in galactosemic rats, nonenzymatic glycation was strongly correlated with DHLNL content. Castration had no effect on crosslink content of collagen from diabetic or galactosemic rats. This study demonstrates that (1) collagen crosslinking is abnormal in granulation tissue collagen in both experimental diabetes and galactosemia, (2) these changes are similar to those observed in skin collagen from insulin-dependent diabetic subjects and (3) the crosslinking abnormalities are not correlated with alterations in collagen solubility. We conclude that hyperglycemia-associated increases in immature crosslinks cannot account for altered collagen solubility, although impaired maturation of such crosslinks may be partially responsible for the lathyrogenic effect of galactosemia.     

Characterization of arylsulfatase C isozymes from human liver and placenta

Arylsulfatase C and steroid sulfatase were thought to be identical enzymes. However, recent evidence showed that human arylsulfatase C consists of two isozymes, s and f. In this study, the biochemical properties of the s form partially purified from human placenta were compared with those of the f form from human liver. Only the placental s form has steroid sulfatase activity and hydrolyses estrone sulfate, dehydroepiandrosterone sulfate and cholesterol sulfate. The liver f form has barely detectable activity towards these sterol sulfates. With the artificial substrate, 4-methylumbelliferyl sulfate, both forms demonstrated a similar KM but the liver enzyme has a pH optimum of 6.9 while the placental form displayed two optima at 7.3 and 5.5. The molecular weight of the native enzyme determined with gel filtration was 183,000 for the s form and 200,000 for the f form and their pI's were also similar at 6.5. However, the T50, temperature at which half of the enzyme activity was lost, was 49.5 degrees C for the f form and 56.8 degrees C for the s form. Polyclonal antibodies raised against the placental form reacted specifically against the s and not the f form. They immuno-precipitated concomitantly greater than 80% of the total placental arylsulfatase C and steroid sulfatase activities while less than 20% of the liver enzyme was immuno-precipitable. In conclusion, the two isozymes s and f of arylsulfatase C in humans purified from placenta and liver, respectively, have similar KM, pI' and native molecular weight. However, they are distinct proteins with different substrate specificity, pH optima, heat-lability and antigenic properties. Only the s form is confirmed to be steroid sulfatase.     

Effects of periodic backflushing on ultrafiltration performance.

Periodic backflushing was introduced to a membrane separation process to improve the performance. Hemoglobin (M.W. = 62,500) and dextran (M.W. = 10,000) were used as model compounds. Filtration performance of an ultrafiltration membrane system (Amicon hollow fiber membrane, H1P30-43, molecular weight cutoff = 30,000) was measured in terms of apparent permeability and retention coefficient of dextran to determine the effects of backflushing frequency and duration of one cycle. An optimum frequency around 0.2 min-1 existed to give a maximum permeability while the retention of dextran decreased with increasing frequencies. The improvement in permeability by periodic backflush was more than doubled. The retention of dextran decreased as backflushing duration was increased in one cycle. With the duration of 33.75 s, the retention of dextran was less than 50% and dextran output was 1.14 g/h, which was 1.3 times the value without backflushing. Also, periodic backflush made possible the long-term filtration of yeast cells for more than 20 h.     

Factors Affecting Germination of Oospores of Phytophthora infestans

When oospores from the pairing between A¹ and A² mating types of Phytophthora infestans were treated with 0.25 % KMnO₄ solution for 15 min and incubated at 19 °C under light on a modified S+L medium, germination commenced within 4 days and reached about 70 % after 20 days. Under these conditions, more than 25 % of oospores obtained from a 4-day-old culture germinated. To obtain a high germination rate of P. infestans oospores, light was essential during germination but not during growth and oospore formation. The optimum time for activation of oospores with 0.25 % KMnO₄ was 15 to 30 min and a suitable concentration of KMnO₄ for 15 min activation was 0.25 to 0.45 %.     

Genetic analysis of superoxide dismutase, the 23 kilodalton antigen of Mycobacterium tuberculosis

The gene encoding a 23 kilodalton protein antigen has been cloned from Mycobacterium tuberculosis by screening of a recombinant DNA library with monoclonal antibodies. The product of the gene has been identified as the superoxide dismutase (SOD) of M. tuberculosis on the basis of sequence comparison and by expression of the recombinant protein in a functionally active form. The derived amino acid sequence of M. tuberculosis SOD reveals a close similarity to manganese-containing SODs from other organisms, in spite of the fact that previous studies using the purified enzyme have identified iron as the preferred metal ion ligand. SOD is present in the extracellular fluid of logarithmic-phase cultures of M. tuberculosis, but the structural gene is not preceded by a signal peptide sequence. Insertion of the M. tuberculosis SOD gene into a novel shuttle vector demonstrated the mycobacteria but is ineffective in Escherichia coli.     

Biodegradation of toxic and environmental pollutants.

Organic chemicals that are toxic to humans and to the environment can be transformed and metabolized by a variety of microorganisms. Such chemicals include trichloroethylene, chloroform, carbon tetrachloride, toluene, phenols, chlorinated phenols, polychlorinated biphenyls and polyaromatic hydrocarbons. This review focuses on some of the most important recent developments in the biodegradation of these toxic chemicals. Depending on the compound and the organism, the extent of our understanding ranges from the molecular level to the conceptual.     

Operation Everest II: metabolic and hormonal responses to incremental exercise to exhaustion.

The reasons for the reduced exercise capacities observed at high altitudes are not completely known. Substrate availability or accumulations of lactate and ammonium could have significant roles. As part of Operation Everest II, peak oxygen uptakes were determined in five normal male volunteers with use of progressively increasing cycling work loads at ambient barometric pressures of 760, 380, and 282 Torr. Decrements from sea level (SL) to 380 and 282 Torr occurred in peak power output (19 and 47%), time to exhaustion (19 and 48%), and oxygen uptake (41 and 61%), respectively. Arterial saturations after exhaustive exercise were decreased to 63% at 380 Torr and 39% at 282 Torr. At 380 and 282 Torr, postexercise plasma concentrations of glucose and free fatty acids were not increased, whereas plasma glycerol concentrations were decreased relative to SL (145 +/- 24 microM at 380 Torr and 77 +/- 10 microM at 282 Torr vs. 213 +/- 24 microM at SL). Preexercise plasma insulin concentrations were elevated at both 380 and 282 Torr (87 +/- 16 pM at 380 Torr and 85 +/- 18 pM at 282 Torr vs. 41 +/- 30 pM at SL). In general, postexercise concentrations of plasma catecholamines were decreased at altitude compared with SL. Preexercise lactate and ammonium concentrations were not different at any simulated altitude. From these data neither substrate availability nor metabolic product accumulation limited exercise capacity at extreme simulated altitude.