Heparin-binding (fibroblast) growth factors are potential autocrine regulators of esophageal epithelial cell proliferation

Summary A serum-free culture system supplemented with neural tissue extract for normal and tumor human esophagi was applied to the culture of mouse esophageal epithelium. Similar to mouse mesenchyme and skin epithelium, esophageal epithelial lines (MEE) emerged after serial culture. The cells had an apparent unlimited life span but retained morphology and other characteristics of normal epithelial cells. The cells formed a small cyst consisting of keratined squamous epithelium in syngenic hosts. A screen for growth factors that stimulated growth of the nonmalignant MEE cells in the absence of neural extract revealed that epidermal growth factor (EGF) and heparin-binding (fibroblast) growth factors (HBGF) were most effective. An HBGF-like activity was apparent in extracts of rapidly proliferating but not quiescent MEE cells at low or confluent densities. A cloned cell line (MEE/C8) was selected from MEE cell cultures in the absence of neural extract. MEE/C8 cells proliferated independent of either EGF or HBGF at rates equal to MEE cells, cell extracts exhibited HBGF-like activity at all stages of proliferation, and the cells formed large invasive tumors in syngenic hosts. The HBGF-like activity present in extracts of tumorigenic MEE/C8 and proliferating nonmalignant MEE cells had properties similar to HBGF-1 (acidic fibroblast growth factor). These results constitute a cultured mouse esophageal epithelial cell model for study of conversion of immortalized premalignant cells to malignant cells, and suggest that conversion from a state of cell cycle-dependent autocrine expression of one or more members of the HBGF family to a state of constitutive expression correlates with and may contribute to malignancy. The work was supported in part by grants CA37589 and DK35310 to Dr. McKeehan, from the National Cancer Institute, Bethesda, MD.     

cis-4-Hydroxy-L-proline and ethyl-3,4-dihydroxybenzoate prevent myogenesis of C2C12 muscle cells and block MyoD1 and myogenin expression.

cis-4-Hydroxy-L-proline (cis-OH-Pro) and ethyl-3,4-dihydroxybenzoate (EDHB), two distinct inhibitors of collagen synthesis, prevented myogenesis in C2C12 mouse skeletal muscle cells. Both inhibitors blocked myotube formation and the expression of sarcomeric myosin heavy chain. Northern blot analysis showed that cis-OH-Pro- and EDHB-treated C2C12 muscle cells did not express the myogenic regulatory genes, MyoD1 and myogenin, but continued to express non-muscle isoforms of actin (beta and gamma) and alpha-tropomyosin. 10TFL2-3B cells, a C3H10T1/2 cell line permanently transfected with myogenin cDNA, constitutively expressed exogenous myogenin in the presence of cis-OH-Pro but failed to activate endogenous myogenin and to undergo myogenesis. These results demonstrate that commitment to terminal differentiation and activation of myogenic regulatory genes requires active synthesis of the extracellular matrix component collagen.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Studies on the hydrolysis of 3-methyl-2′-deoxycytidine in aqueous solution A synthesis of 3-methyl-2′-deoxyuridine

The hydrolysis of 3-methyl-2′-deoxycytidine in aqueous solution has been investigated. Varying proportions of 3-methylcytosine, 3-methyluracil and 3-methyl-2′-deoxyuridine are formed depending upon conditions of pH and temperature. All three hydrolytic products are formed at pH 6.8 and 90°C. At pH 2, depyrimidination of 3-methylcytosine occurs as the only hydrolysis product. When the pH is increased to 12, 3-methyl-2′-deoxycytidine on heating at 90°C is completely deaminated to 3-methyl-2′-deoxyuridine with few side products formed. This reaction serves as the basis for a convenient synthesis of 3-methyl-2′-deoxyuridine. The 300 MHz spectra of 3-methyl-2′-deoxycytidine and 3-methyl-2′-deoxyuridine indicate that the sugar ring in these compounds is predominantly in ²E conformation.     

Decreased alpha 1-adrenoceptor responsiveness and density in liver cells of thyroidectomized rats

The effects of hypothyroidism on the hepatic alpha 1-receptor system were studied in isolated rat liver cells. Phenylephrine and vasopressin caused concentration-dependent activation of glycogen phosphorylase and release of 45Ca from 45Ca-loaded cells in either normal or thyroidectomized rats. However, the magnitude of both responses to phenylephrine was markedly suppressed after thyroidectomy and could be restored to near normal levels by in vivo treatment with 1-triiodothyronine (0.25 mg/kg/day) for 4 days. The potency of vasopressin to induce phosphorylase activation and 45Ca release was only slightly reduced by thyroidectomy. Binding of [3H]prazosin to putative alpha 1-receptors in purified liver plasma membranes revealed that the above changes were accompanied by a decrease in the density of binding sites from 567 +/- 51 fmol/mg of protein in controls to 326 +/- 51 fmol/mg in thyroidectomized rats and a return to 498 +/- 23 fmol/mg in thyroidectomized rats treated with 1-triiodothyronine. The affinity of binding sites for [3H]prazosin or for alpha-receptor agonists was the same in the three groups of rats and affinity for epinephrine was unaffected by the presence of guanyl-5'-yl imidodiphosphate (30-100 microM). From these findings, it appears that a reduction in the number of hepatic alpha 1-receptors is responsible for the selective decrease in alpha-adrenergic responses in the hypothyroid rat liver. These changes are opposite to those previously reported for hepatic beta-receptors.     

The Light-harvesting Chlorophyll a/b-Protein Complex of Chlamydomonas reinhardii

The molecular organization of chlorophyll in Chlamydomonas reinhardii has been shown to be essentially similar to that in higher plants. Some 50% of the chlorophyll in Chlamydomonas reinhardii chloroplast membranes has been shown to be located in a chlorophyll a/b-protein complex. The complex was isolated in a homogeneous form by hydroxylapatite chromatography of sodium dodecyl sulfate extracts of the chloroplast membranes. Its absorption spectrum exhibits two maxima in the red region at 670 and 652 nm due to the presence of equimolar quantities of chlorophylls a and b in the complex. Preparations of the chlorophyll-protein also contain some of each of the carotenoids observed in the intact chloroplast membrane, but not in the same proportions. The native complex (S value = 2.3S) exhibits a molecular weight of 28,000 ± 2,000 on calibrated sodium dodecyl sulfate-polyacrylamide gel electrophoresis. However, on the basis of its amino acid composition and other data a more probable molecular weight of about 35,000 was calculated. Each 35,000 dalton unit contains three chlorophyll a and three chlorophyll b molecules, and on the average one carotenoid molecule conjugated with probably a single polypeptide of 29,000 daltons. Comparison of spectral and biochemical characteristics demonstrates that this algal chlorophyll-protein is homologous to the previously described major light-harvesting chlorophyll a/b-protein of higher plants. It is anticipated that the Chlamydomonas complex functions solely in a light-harvesting capacity in analogy to the function determined for the higher plant component.     

Hereditary respiration deficiency in Saccharomycodes ludwigii

Saccharomycodes ludwigii, supposed to be petite-negative, gave rise to respiration-deficient mutants when acriflavine and ultraviolet irradiation, respectively, were applied to this yeast, strain IFO 1194. The frequency of such mutants was very low as compared with that in Saccharomyces cerevisiae and other petite-positive yeasts. Cytochrome composition was characterized by spectrophotometry at the temperature of liquid nitrogen. The respiratory mutants examined contained cytochrome c unaltered in quality and quantity. Cytochrome b was often present only in small amounts though never absent, while cytochrome a+a₃ was either present or absent. The respiratory mutants could form zygotes after conjugation with a wild-type culture of opposite mating type ( vs. a). The hybridization and segregation analysis of spore tetrads showed the inheritance of respiratory mutant character to be either Mendelian or non-Mendelian and similar to that of pet (nuclear) and rho^- (cytoplasmic) mutants, respectively, in Saccharomyces cerevisiae.     

Zoogeography of Intertidal Communities in the West Indian Ocean as Determined by Ocean Circulation Systems: Patterns from the Tetraclita Barnacles

The Indian Ocean is the least known ocean in the world with the biogeography of marine species in the West Indian Ocean (WIO) understudied. The hydrography of WIO is characterized by four distinct oceanographic systems and there were few glacial refugia formations in the WIO during the Pleistocene. We used the widely distributed intertidal barnacle Tetraclita to test the hypothesis that the distribution and connectivity of intertidal animals in the WIO are determined by the major oceanographic regime but less influenced by historical events such as Pleistocene glaciations. Tetraclita were studied from 32 locations in the WIO. The diversity and distribution of Tetraclita species in the Indian Ocean were examined based on morphological examination and sequence divergence of two mitochondrial genes (12S rDNA and COI) and one nuclear gene (histone 3, H3). Divergence in DNA sequences revealed the presence of seven evolutionarily significant units (ESUs) of Tetraclita in WIO, with most of them recognized as valid species. The distribution of these ESUs is closely tied to the major oceanographic circulation systems. T. rufotincta is distributed in the Monsoonal Gyre. T. ehsani is present in the Gulf of Oman and NW India. Tetraclita sp. nov. is associated with the Hydrochemical Front at 10°S latitude. T. reni is confined to southern Madagascan and Mauritian waters, influenced by the West Wind Drift. The endemic T. achituvi is restricted to the Red Sea. Tetraclita serrata consists of two ESUs (based on mtDNA analysis) along the east to west coast of South Africa. The two ESUs could not be distinguished from morphological analysis and nuclear H3 sequences. Our results support that intertidal species in the West Indian Ocean are associated with each of the major oceanographic circulation systems which determine gene flow. Geographical distribution is, however, less influenced by the geological history of the region.