Changes in nonhistone chromosomal proteins in phytohemagglutininstimulated lymphocytes

Stimulation of bovine lymphocytes with phytohemagglutinin results in quantitative as well as qualitative changes in the nonhistone chromosomal proteins. Analysis of these proteins by hydroxyapatite chromatography and sodium dodecylsulfate polyacrylamide gel electrophoresis shows not only a selective increase in the amount of some nonhistone proteins but also a decrease of other nonhistone protein bands. This observation is compatible with the view that nonhistone proteins have an inhibitory as well as an activating function at the genome level.     

Amino acid transport in the rat exocrine pancreas

Summary Amino acid transport and incorporation have been studied in vitro in rat pancreatic lobules after maximal and supramaximal hormonal stimulation with caerulein. Incorporation into proteins was increased already after 30 and 120 min of maximal stimulation, but was decreased after the infusion of a supramaximal dose. Uptake of neutral amino acids was monitored using labeled leucine and -aminoisobutyric acid (AIB). In the case of leucine the free pool was consistently reduced after maximal stimulation, while supramaximal doses led to an increase which could be potentiated by the addition of 2mM tetracaine. Using AIB, a significant increase in the intracellular pool was observed after maximal stimulation, conversely a decrease after supramaximal stimulation. Release of labeled leucine and AIB from preloaded lobules during incubation in the cold was significantly reduced after maximal secretory stimulation, but was found enhanced by 200 to 300 percent after supramaximal stimulation. No fine structural alterations at junctional complexes or at both the lateral and luminal plasma membranes were observed after maximal stimulation except an increased number of exocytotic figures at the luminal face. However, supramaximal stimulation led to progressive rarefaction of the tight junctional network and disintegration of the gap junctions. Concomitantly, an equal distribution of membrane particles on both faces of the plasma membrane together with a random occurrence of exocytotic figures were observed.Supported by a grant from the Deutsche Forschungsgemeinschaft, Bonn-Bad Godesberg (SFB 122, project C 5). Dedicated to Professor Dr. Gerhard Petry, Marburg, on the occasion of his 65th birthday     

RNA synthesis in isolated polytene nuclei from Chironomus tentans

An RNA synthesizing system with isolated polytene nuclei from Chironomus tentans is described. This system allows one to monitor the effect of salt concentration on chromosome structure and to assign in vitro RNA synthesis to structural modifications of the chromosome (i.e. nucleoli, Balbiani rings and puffs).-At a salt concentration of 0.15 M monovalent cations (standard salt medium=SSM) chromosomal structure appears to be best preserved during in vitro incubation. At low and high ionic strength the bands decondense and the microscopically visible chromosomal structure is lost completely. These three states of condensation and decondensation are distinguished with respect to RNA synthesis: (1) in low salt overall RNA synthesis is depressed, (2) in SSM ribosomal RNA synthesis predominates and continues for 30 min, (3) in high salt RNA synthesis is stimulated 3–4 fold again. This stimulation is due solely to chromosomal, non-ribosomal RNA synthesis, which proceeds in high salt for more than 10 h, though new initiation of RNA chains is prevented. Molecular weight determinations of the RNA synthesized demonstrate a time dependent increase in size of the newly synthesized molecules under these conditions. — Autoradiographs of nuclei incubated in SSM reveal prominent label in nucleoli, significant label in Balbiani rings and rather reduced activity at other sites. Addition of various exogenous RNA polymerases does not markedly alter this pattern. Autoradiographs of nuclei incubated in high salt exhibit extensive RNA synthesis spread over the chromosomes. Preparations of autoradiographs from isolated chromosomes show that the high salt induced label is localized in single bands. Though the majority of bands is still unlabelled, the actual number of bands exhibiting incorporation in high salt is higher than in any individual functional state in vivo. These results are discussed in terms of activated and preactivated genes.     

Isolation of a domain of the plasma membrane in Chinese hamster ovary cells which contains iodinatable, acidic glycoproteins of high molecular weight

A light vesicle fraction, apparently derived from the plasma membrane, was obtained following breakage of Chinese hamster ovary (CHO) cells by means of a fluid pump disrupting device. The final preparation was enriched approx. 40-fold over the homogenate in K+,Na+-stimulated ATPase and phosphodiesterase I, but only approx. 10-fold in 125I specific radioactivity after lactoperoxidase-catalyzed iodination. This preparation was compared with another plasma membrane fraction purified as large sheets via a two-phase centrifugation procedure. Two-dimensional polyacrylamide gel electrophoresis followed by Coomassie blue staining indicated that both fractions were fairly similar in polypeptide composition, although a few consistent differences were evident. However, staining of glycoproteins by the periodic acid-Schiff technique or by overlaying with 125I-labeled concanavalin A showed that the vesicle fraction was highly enriched in groups of high molecular weight, acidic glycoproteins which stain only weakly with Coomassie blue. These glycoproteins also bound 125I-labeled ricin I agglutinin and wheat germ agglutinin. They appear to be the major receptors for wheat germ agglutinin on the CHO cell surface. After surface labeling of cells by the 125I-lactoperoxidase technique, the membrane sheet fraction contained a large number of iodinated polypeptides, whereas labeling in the vesicle fraction was restricted almost entirely to the high molecular weight, acidic glycoproteins. It is proposed that the vesicle fraction constitutes a specific domain of the cell surface which is coated on its exterior by this group of glycoproteins. These components probably mask underlying proteins of the plasma membrane from external labeling.     

Intercellular junctions in the uterine epithelium of Salamandra salamandra (L.) (Amphibia,Urodela)

Summary Intercellular junctions in the uterine epithelium of the ovoviviparous urodele Salamandra salamandra were studied in pregnant and non-pregnant females by freeze-fracture technique. Junctional complexes consist of zonulae occludentes (tight junctions) and numerous maculae adhaerentes (desmosomes); z. adhaerentes and nexuses (gap junctions) could not be identified. Tight junctions are of the flexible type exhibiting loosely interconnected fibrils. The fibrillary network appears stretched more often in pregnant females possibly due to the mechanical stress of pregnancy. The structure and occurrence of the junctions identified, especially that of the tight junctions, is discussed with regard to the functions of the uterus during pregnancy.Zusammenfassung Mit Hilfe der Gefrierbruchtechnik wurden im Uterus-epithel trächtiger und nichtträchtiger Feuersalamanderweibchen (Salamandra salamandra) Zonulae occludentes und Maculae adhaerentes, jedoch keine Z. adhaerentes sowie Nexus identifiziert. Die Z. occludentes sind flexibel. Ihr fibrilläres Netzwerk ist bei trächtigen Weibchen öfter gestreckt; das ist möglicherweise auf die stärkere Ausdehnung des Uterusgewebes während der Trächtigkeit zurückzuführen. Das Vorkommen der verschiedenen Kontakt-strukturen, namentlich das der Z. occludentes, wird im Hinblick auf die Funktionen des Uterus während der Trächtigkeit diskutiert.We are indebted to Mrs. K. Ott for excellent technical assistance and to Miss Dr. U. Beigel for linguistic help     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Binding properties of 23S,25-dihydroxyvitamin D3: an in vivo metabolite of vitamin D3

23$\text{S}$,25-Dihydroxyvitamin D₃ was isolated from the plasma of vitamin D₃-toxic pigs. An ultraviolet absorbance spectrum confirmed its purity. The configuration of the 23-hydroxyl group was determined to be S by comparison of the natural product with synthetic 23$\text{R}$,25- and 23$\text{S}$,25-dihydroxyvitamin D₃ by high-pressure liquid chromatography. The affinity of both 23$\text{S}$,25- and 23$\text{R}$,25-dihydroxyvitamin D₃ for the plasma vitamin D binding protein was similar to vitamin D₃. Thus, with respect to the plasma vitamin D binding protein, 23$\text{S}$,25-dihydroxyvitamin D₃ is the least potent, naturally-occurring, dihydroxylated vitamin D₃ metabolite known.     

The inhibitory effect of ethanol on ethanol production by Zymomonas mobilis

Summary In an effort to establish the reasons for the limitations in the final ethanol concentration of Zymomonas mobilis fermentation, the effects of CO₂ and ethanol on the fermentation were investigated using continuous and fed-batch cultivation systems. The nucleation and stripping out of CO₂ from the fermenter using diatomaceous earth or nitrogen gas or both exhibited a profound effect on the glucose uptake rate during the early stages of fed-batch fermentation, but did not improve final ethanol yields. The addition of ethanol together with above mentioned experiments confirmed conclusively that ethanol inhibition is responsible for the final ethanol concentration obtainable during Zymomonas mobilis fermentation. The final concentration lies between 90 and 110 gl⁻¹ or approximately 12–15% (v/v) ethanol.     

1,25-Dihydroxyvitamin D3 receptor in bovine thymus gland

1,25-Dihydroxyvitamin D₃ [1,25-(OH)₂D₃] receptor was characterized after partial purification of thymus cytosol by ammonium sulfate fractionation. The 1,25-(OH)₂D₃ receptor sediments at 3.7S in 5–20% sucrose gradients. The binding of 1,25-(OH)₂D₃ in thymic cytosol was a saturable process with high affinity (Kd = 0.12?0.48 nM) at 4°C. Competition for 1,25-(OH)₂[³H]D₃ receptor by nonradioactive analogs demonstrated the affinities of these analogs to be in order; 1,25-(OH)₂D₃ = 1,24R,25-(OH)₃D₃ = 1,25S,26-(OH)₃D₃ = 1,25R,26-(OH)₃D₃ > 1,25-(OH)₂D₃-26,23 lactone > 25-OHD₃ > 23R,25-(OH)₂D₃ > 24R,25-(OH)₂D₃ > 23S,25-(OH)₂D₃ ? 25-OHD₃-26,23 lactone. The receptor bound to DNA cellulose columns in low salt buffer and eluted as a single peak at 0.21 M KCl. These findings provide evidence that the thymus possesses a 1,25-(OH)₂D₃ receptor with properties indistinguishable from 1,25-(OH)₂D₃ receptors in other tissues.