Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.     

Molecular cloning and differential expression of somatic and testis-specific H2B histone genes during rat spermatogenesis

We have cloned cDNA of a testis-specific histone, TH2B (a variant of H2B), and rat somatic H2B gene to investigate regulation of testis-specific histone genes during rat spermatogenesis. The amino acid sequences deduced from DNA sequences show extensive sequence divergence in the N-terminal third of the two histones. The rest is highly conserved. One cysteine residue was found in TH2B. No cysteine is present in somatic histones except in H3 histone. We investigated the expression of TH2B and H2B genes using the regions of sequence divergence as hybridization probes. The TH2B gene is expressed only in the testis, and the expression of this gene is detected 14 days after birth, reaching a maximum at Day 20. The level of H2B mRNA shows a reciprocal pattern. This contrasting pattern can be explained by the gradually changing proportion of spermatogonia and spermatocytes with testicular maturation. In situ cytohybridization studies show that H2B gene is expressed primarily in proliferating spermatogonia and preleptotene spermatocytes, whereas TH2B gene is expressed exclusively in pachytene spermatocytes which first appear in testis about 14 days after birth. H2B and TH2B genes appear to be ideal markers for the study of proliferation and differentiation events in spermatogenesis and their regulatory mechanisms.     

Semiquantitative calculations of catalytic free energies in genetically modified enzymes

The catalytic free energy and binding free energies of the native and the Asn-155----Thr, Asn-155----Leu, and Asn-155----Ala mutants of subtilisin are calculated by the empirical valence bond method and a free energy perturbation method. Two simple procedures are used; one "mutates" the substrate, and the other "mutates" the enzyme. The calculated changes in free energies (delta delta G not equal to cat and delta delta Gbind) between the mutant and native enzymes are within 1 kcal/mol of the corresponding observed values. This indicates that we are approaching a quantitative structure-function correlation. The calculated changes in catalytic free energies are almost entirely due to the electrostatic interaction between the enzyme-water system and the charges of the reacting system. This supports the idea that the electrostatic free energy associated with the changes of charges of the reacting system is the key factor in enzyme catalysis.     

Flow profiles and wall shear stress distribution at a hemodialysis venous anastomosis: preliminary study

The phasic velocity field in the vicinity of the venous anastomosis in a hemodialysis angioaccess arteriovenous fistula loop graft (AVLG) is investigated employing a laser Doppler anemometer (LDA) system. Detailed LDA velocity profiles are obtained by sectional survey performed in a transparent, elastic flow model which was fabricated to represent the geometry of the AVLG system under physiological pressure and flow waveforms. The geometry of the flow model was based on a silicone rubber cast obtained from an experimental dog model. In the present study, detailed distribution of velocity profiles is obtained. The distribution of wall shear stress in the model is computed from the slope of the local velocity profiles near the wall. The relationship between the results obtained by flow visualization and the LDA measurement is discussed.     

Immunocytochemical identification of prolactin cells in the pituitary gland of tilapia larvae (Oreochromis mossambicus: Teleostei)

Summary Using an antiserum to highly purified chum salmon prolactin, prolactin cells were identified in the putative rostral pars distalis of newly hatched tilapia larvae (Oreochromis mossambicus) by the immunogold method for the electron microscope. In the putative rostral pars distalis, some cells had another kind of secretory granule which was much less numerous, much smaller in size, and without immunoreactivity to salmon prolactin antiserum. Controls incubated with salmon prolactin-preabsorbed antiserum or normal serum showed no immunoreactive cells, confirming the specificity of the antiserum. The possible role of prolactin in the osmoregulation of tilapia larvae is discussed.     

Rare McArdle disease locus polymorphic site on 11q13 contains CpG sequence

Summary When probes throughout the McArdle disease (myophosphorylase) gene region were used to search for DNA polymorphisms, only an MspI polymorphism was found in 94 enzyme-probe combinations. Along with an insertion/deletion polymorphism more 3 to the gene locus, these polymorphisms will be informative in 75% of at-risk patients. These results contrast strikingly to the six polymorphic sites detected in 15 enzyme-probe combinations in the homologous Her's disease (liver phosphorylase) gene region. This single MspI polymorphic site includes a CpG sequence of known increased mutability suggesting that DNA regions with rare polymorphisms will have most polymorphic sites at sequences with enhanced mutability. Fluorescence in situ hybridization sublocalized this gene to proximal band 11q13, establishing a point of cross-reference between the physical and genetic maps.     

Transitional changes in arachidonic acid metabolism by bovine embryos at different developmental stages

In order to determine the profile of arachidonic acid (AA) metabolites synthesized by bovine embryos during early developmental stages, embryos collected from superovulated beef cattle (days 6 through 17) were incubated with AA and its metabolites were analyzed by high performance liquid chromatography and radioimmunoassay (RIA). Embryos harvested and cultured before day 12 of the estrous cycle metabolized AA primarily to prostaglandin E2 (PGE2), whereas, those harvested on day 13 of the cycle metabolized AA to both PGE2 and PGF2 alpha. Furthermore, embryos collected after day 15 of the cycle metabolized AA to PGI2 in addition to PGE2 and PGF2 alpha. In view of the luteotropic properties that have been attributed to PGE2 and the vasodilatory effect of PGI2, this transitional change in prostaglandin synthesis during early stages of embryonic development may be a part of the mechanism by which the embryo exerts a luteotropic effect leading to maternal recognition of pregnancy and by which the conceptus begins preparing for subsequent implantation.     

Thermal requirements for development of aphidophagous Coccinellidae (Coleoptera), Chrysopidae,Hemerobiidae (Neuroptera), and Syrphidae (Diptera): some general trends

Summary The sum of effective temperatures (SET) and lower development threshold (LDT) were established for eggs and/or pupae of central European populations of 20 species of chrysopid, coccinellid, hemerobiid, and syrphid predators of aphids. LDT ranged between 5.6° and 12.2°C, SET between 38.3 and 140.9 day degrees (dd), with broad overlap among stages and taxa. When LDT was plotted against SET, the data for both eggs and pupae were scattered along a single regression line which predicted a 0.47°C decrease in LDT per 10 dd increase in SET (r=-0.77, p<0.001). A regression calculated from published data from all over the world predicted a 0.24°C/10 dd decrease in LDT, and the data were more scattered (r=-0.38, p<0.01). This is perhaps the first report on the functional relationship between LDT and SET at the interspecific level. The species and stages differed in typical development length (VDL) and in the extent of its deceleration by low temperatures (DD). DD increased with increasing VDL, but the relative effect of low temperature on development length (DD/VDL ratio) reflected thermal adaptations consistent with the life history of the species. Polyvoltine species were less affected by low temperatures than monovoltine species, particularly the thermophilic ones.     

Comparative analysis of glycoprotein and glycolipid composition of virulent and avirulent strain membranes ofMycoplasma hyopneumoniae

The glycoproteins and glycolipids from membranes of virulent strain Z and avirulent strain M ofMycoplasma hyopneumoniae have been compared. The proteins and the glycoproteins were identified by SDS-polyacrylamide gel electrophoresis and concanavalin A-biotin labeling, respectively. The membrane preparation contained approximately 34 protein bands with molecular weights between 20 KD and 100 KD. The concanavalin A-biotin system reacted with a glycoprotein of a molecular weight of approximately 28,000 from avirulent strain M and did not react with the correspondent band from virulent strain Z. The membrane glycolipids of both strains consisted of monogalactosyldiacylglycerol (MGDG) and digalactosyldiacylglycerol (DGDG), and the percentages of 160, 180, and 181 fatty acids comprised more than 80% of the total fatty acids of membrane glycolipids. The 180 fatty acid of MGDG in avirulent strain M was twofold higher than that of virulent strain Z.