Lactate and epinephrine during exercise in altitude natives

Kayser, Bengt, Roland Favier, Guido Ferretti, DominiqueDesplanches, Hilde Spielvogel, Harry Koubi, Brigitte Sempore, and HansHoppeler. Lactate and epinephrine during exercise in altitudenatives. J. Appl. Physiol. 81(6):2488-2494, 1996.We tested the hypothesis that the reported lowblood lactate accumulation ([La]) during exercise inaltitude-native humans is refractory to hypoxia-normoxia transitions byinvestigating whether acute changes in inspiredO₂ fraction(FI_O2) affect the[La] vs. power output ()relationship or, alternatively, as reported for lowlanders, whetherchanges in [La] vs. on changes inFI_O2 are related tochanges in blood epinephrine concentration ([Epi]). Altitude natives [n = 8, age 24 ± 1 (SE) yr, body mass 62 ± 3 kg, height 167 ± 2 cm]in La Paz, Bolivia (3,600 m) performed incremental exercise with twolegs and one leg in chronic hypoxia and acute normoxia (AN). Submaximalone- and two-leg O₂ uptake (O₂) vs. relationships were not altered byFI_O2. AN increased two-legpeak O₂ by 10% and peak by 7%. AN paradoxically decreasedone-leg peak O₂ by 7%,whereas peak remained the same. The[La] vs. relationships were similar tothose reported in unacclimatized lowlanders. There was a shift to theright on AN, and maximum [La] was reduced by 7 and 8% forone- and two-leg exercises, respectively. [Epi] and[La] were tightly related (mean r = 0.81) independently ofFI_O2. Thus normoxiaattenuated the increment in both [La] and [Epi]as a function of , whereas the correlation between[La] and [Epi] was unaffected. These data suggest loose linkage of glycolysis to oxidative phosphorylation under influence from [Epi]. In conclusion, high-altitudenatives appear to be not fundamentally different from lowlanders with regard to the effect of acute changes inFI_O2 on [La] during exercise.

     

Treatment of Helicobacter pylori Infection: A Review of the World Literature

Background. None of the currently used anti- Helicobacter pylori drug regimens cures the infection 100%, and cure results still vary considerably. The present article reviews the effectiveness of currently used antimicrobial regimens, aimed to cure H. pylori infection.
Methods. Data collection started from the beginning of the anti- H. pylori -therapy era until May 1995. No attempt at formal metanalysis has been made, because many studies have been published only in abstract form. Attempts were made to exclude duplicates of studies by comparison to previously reported ones; the authors of suspected duplicates were contacted. After amalgamation of the number of included patients and the number of successfully treated patients, the mean values of eradication rates and the 95% confidence intervals were calculated.
Results. A total of 237 treatment arms were analyzed. Bismuth triple therapy continues to reach high eradication rates worldwide (78–89%). Side effects leading to diminished patient compliance and the marked decline of eradication efficacy in cases of metronidazole resistance are considered to be the major drawbacks of this therapy. Proton pump inhibitor (PPI) dual therapy is better tolerated with fewer side effects than is bismuth triple therapy. The mean eradication rates vary from 55 to 75%, and the extremes lie between 24 and 93%. PPI triple therapies have been shown to be very effective against H. pylori (eradication rates, 80–89%). Quadruple therapy leads to a mean eradication rate of 96%.
Conclusion. Based on efficacy, PPI triple or bismuth triple therapy are recommended as first-line treatment for H. pylori infection. Quadruple therapy could serve as second-line treatment for eradication of initial failures and in case of metronidazole resistance.     

Enhanced quantitative resistance against fungal disease by combinatorial expression of different barley antifungal proteins in transgenic tobacco

cDNAs encoding three proteins from barley ( Hordeum vulgare ), a class-II chitinase (CHI), a class-II β-1,3-glucanase (GLU) and a Type-I ribosome-inactivating protein (RIP) were expressed in tobacco plants under the control of the CaMV 35S-promoter. High-level expression of the transferred genes was detected in the transgenic plants by Northern and Western blot analysis. The leader peptides in CHI and GLU led to accumulation of these proteins in the intercellular space of tobacco leaves. RIP, which is naturally deposited in the cytosol of barley endosperm cells, was expressed either in its original cytosolic form or fused to a plant secretion peptide (spRIP). Fungal infection assays revealed that expression of the individual genes in each case resulted in an increased protection against the soilborne fungal pathogen Rhizoctonia solani , which infects a range of plant species including tobacco. To create a situation similar to 'multi-gene' tolerance, which traditional breeding experience has shown to provide crops with a longer-lasting protection, several of these antifungal genes were combined and protection against fungal attack resulting from their co-expression in planta was evaluated. Transgenic tobacco lines were generated with tandemly arranged genes coding for RIP and CHI as well as GLU and CHI. The performance of tobacco plants co-expressing the barley transgenes GLU/ CHI or CHI/RIP in a Rhizoctonia solani infection assay revealed significantly enhanced protection against fungal attack when compared with the protection levels obtained with corresponding isogenic lines expressing a single barley transgene to a similar level. The data indicate synergistic protective interaction of the co-expressed anti-fungal proteins in vivo .     

Chemie und Systematik in der FlechtengattungRhizocarpon: Hochdruckflüssigkeitschromatographie (HPLC) der Flechten-Sekundärstoffe derRhizocarpon superficiale-Gruppe

The secondary lichen products of 31 specimens of theRhizocarpon superficiale group are examined by high performance liquid chromatography (HPLC). At 260 nm 13 different compounds have been detected. 6 of them are well-known lichen acids which occur in nearly all the species; but proportions are different and constant for each species. An analytical key is added.

Beitrag I einer Publikationsreihe.     

Cytochrome P-450 and glutathione: what is the significance of their interrelationship in lipid peroxidation?

Both cytochrome P-450 and glutathione participate in the metabolism of xenobiotics. Their interrelationship is described here, as well as current findings indicating their mutual involvement in lipid peroxidation.     

Amino acid transport in the rat exocrine pancreas

Summary Amino acid transport and incorporation have been studied in vitro in rat pancreatic lobules after maximal and supramaximal hormonal stimulation with caerulein. Incorporation into proteins was increased already after 30 and 120 min of maximal stimulation, but was decreased after the infusion of a supramaximal dose. Uptake of neutral amino acids was monitored using labeled leucine and -aminoisobutyric acid (AIB). In the case of leucine the free pool was consistently reduced after maximal stimulation, while supramaximal doses led to an increase which could be potentiated by the addition of 2mM tetracaine. Using AIB, a significant increase in the intracellular pool was observed after maximal stimulation, conversely a decrease after supramaximal stimulation. Release of labeled leucine and AIB from preloaded lobules during incubation in the cold was significantly reduced after maximal secretory stimulation, but was found enhanced by 200 to 300 percent after supramaximal stimulation. No fine structural alterations at junctional complexes or at both the lateral and luminal plasma membranes were observed after maximal stimulation except an increased number of exocytotic figures at the luminal face. However, supramaximal stimulation led to progressive rarefaction of the tight junctional network and disintegration of the gap junctions. Concomitantly, an equal distribution of membrane particles on both faces of the plasma membrane together with a random occurrence of exocytotic figures were observed.Supported by a grant from the Deutsche Forschungsgemeinschaft, Bonn-Bad Godesberg (SFB 122, project C 5). Dedicated to Professor Dr. Gerhard Petry, Marburg, on the occasion of his 65th birthday     

Effect of temperature on the stability and activity of crystalline ox liver nuclear and mitochondrial glutamate dehydrogenases

A study on the response of the stability and activity of crystalline ox liver nuclear and mitochondrial glutamate dehydrogenases to temperature variations has been carried out. The thermodynamic properties of the heat inactivation process and of the reaction with the substrates glutamate and α-ketoglutarate have been investigated. The heat inactivation of nuclear glutamate dehydrogenase proceeds at a faster rate than that of the mitochondrial enzyme in the temperature range 40–51 °C; the enthalpy of activation of the inactivation process is higher and the entropy is almost double, compared to the values of mitochondrial glutamate dehydrogenase. The effect of temperature on the maximal velocity shows that, with both glutamate and α-ketoglutarate, the enthalpy of activation with nuclear glutamate dehydrogenase is double and the decrease in entropy almost half of the values of the mitochondrial enzyme. The variation of the apparent K_m with temperature shows a decrease of the affinity of both enzymes for glutamate, with no major difference in the thermodynamic properties of the reaction. With α-ketoglutarate, on the other hand, the affinity of nuclear glutamate dehydrogenase decreased, whereas that of the mitochondrial enzyme increased with temperature. The process is therefore exothermic with the former enzyme, endothermic with the latter; furthermore, it occurs with a decrease in enthropy with nuclear glutamate dehydrogenase, but with a large increase with the mitochondrial enzyme. The studies on the effect of temperature on the activity were carried out in the range 20–44 °C.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

R-factor-mediated suppression of the galactose-sensitive phenotype of Escherichia coli K-12 galE mutants

Plasmids S-a and Rts1 suppress the galactose-sensitive phenotype of galE mutants of Escherichia coli K-12, giving rise to both galactose-fermenting and nonfermenting strains. Fermenting strains produce normal inducible UDP-galactose epimerase. Plasmids extracted from either a fermenting or a nonfermenting strain are indistinguishable when examined by either measurements of length of relaxed circular molecules by electron microscopy or electrophoretic pattern of restriction endonuclease digestion products. The phenomenon could be explained by reversible recombination between a plasmid-borne epimerase gene and homologous chromosomal sequences.     

The enzymatic system thiosulfate: Cytochrome c oxidoreductase from photolithoautotrophically grown Rhodopseudomonas palustris

Rhodopseudomonas palustris cells, characterized by a lamellar type intracytoplasmic chromatophore membrane system after phototrophic growth, yielded a crude supernatant cell-free fraction (S-144) after ultracentrifugation which retained the contents of both the cell compartments. After thiosulfate-dependent growth, a protein system was isolated from S-144 which catalyzed the thiosulfate-linked reduction of an endogenous c-type cytochrome. — The colorless oxidoreductase protein, after purification to homogeneity, revealed a molecular weight of 93,000 and, after SDS treatment, a particle weight of 48,000. It was focused at an average pI of 5.45. Apparent K _m values for several substrates were in the M range. The electron acceptor for thiosulfate oxidation was found to be a cytochrome c from S-144. The homogeneous acceptor protein, at liquid nitrogen temperature, exhibited absorption maxima at 549.0, 518.5 and 418.0 nm, and shoulders at 525.5, 512.0 and 508.0 nm. Its molecular weight was found to be 17,000 (gel filtration) and 16,000 (SDS gel electrophoresis). It was characterized by a pI of 10.0. Its midpoint redox potential of E _m,7.0=+228 mV was determined by redox titrations and the value of +205 mV by spectrophotometric calculations.Abbreviations BSA bovine serum albumin - HiPIP high potential nonheme iron protein - IEF isoclectric focusing - SDS dodecylsulfate, sodium salt - Temed N,N,N,N-tetramethylethylenediamine