Carboxylmethylation of Calmodulin in Cultured Pituitary Cells

We have used fast protein liquid chromatography (FPLC) and reverse-phase HPLC to rapidly resolve carboxylmethylated proteins in cultured pituitary GH3 cells. This procedure preserves labile carboxylmethyl esters, which are lost under the usual procedures employed for protein fractionation. GH3 cells were incubated with [methyl-3H]-methionine in culture and incorporation of label into the soluble fraction, total cell protein, and protein carboxylmethyl esters was determined; protein carboxylmethyl ester formation was shown to be resistant to cycloheximide. Fractionation of protein carboxylmethyl esters from GH3 cells by gel permeation FPLC, anion-exchange FPLC, and reverse-phase HPLC in the presence of calcium and in the presence of EGTA identified two proteins that are major substrates for protein carboxylmethyltransferase and indicated that one of these proteins is calmodulin. Similar results were obtained when a cytosolic fraction from GH3 cells was incubated with S-adenosyl-L-[methyl-3H]methionine. These results indicate that rapid chromatography at low temperature and low pH is useful for the analysis of eucaryotic carboxylmethylated proteins and that contrary to reports obtained in other systems, calmodulin is carboxylmethylated in intact pituitary cells.     

Reproductive success,spontaneous embryo abortion,and genetic load in flowering plants

Summary Reproductive success is divided into two phases: preemergent (the number of viable seeds that enter the ambient environment) and postemergent (the percentage of progeny that survive to reproduce). We studied preemergent reproductive success (PERS) in flowering plants by measuring the fruit/flower (Fr/Fl) ratio and the seed/ovule (S/O) ratio in a number of species of outcrossing and inbreeding plants, where PERS=the product of (Fr/Fl) and (S/O). In order to determine the influence of the ambient environment (including resource availability) we studied pairs of outcrossing and inbreeding species occurring in the same habitat. Among outcrossing species PERS averaged about 22%, whereas in inbreeding species the average was approximately 90%. The progeny/zygote (P/Z) ratio was studied in hand-pollinated populations in Epilobium angustifolium (a strongly outcrossing species) from populations in Oregon and Utah, by direct observation of embryogenesis at twoday intervals throughout the course of seed development. The P/Z ratio in both populations averaged near 30%, and the developing embryos showed a surprising array of abnormalities that resulted in embryo death. During early development >95% of the ovules had normally developing globular embryos, but beginning with differentiation (cotyledon formation) about 70% of the original globular embryos aborted during the course of embryogenesis and seed development. The clustering of developmental lethals during peroids of major differentiation events parallels the animal model of development. We found little evidence that PERS was limited by the ambient environment (including resource availability), pollination, or factors associated with the inbreeding habit. Instead, PERS was found to be inextricably linked to outcrossing plants, whose breeding systems promote genetic variability. The high incidence of developmental lethals in E. angustifolium and the resulting low P/Z ratio (ca. 30%) is attributed to genetic load (any lethal mutation or allelic combination) possibly working in combination with developmental selection (interovarian competition among genetically diverse embryos). Examples of maternally controlled, fixed patterns of ovule abortion with respect to position or number are discussed. However, we found no need to employ female choice as a hypothesis to explain our results for the extensive, seemingly random patterns of embryo abortion in E. angustifolium and other outcrossing species. A more parsimonious, mechanistic explanation based on genetic load-developmental selection is sufficient to account for the differential survivorship of embryos. Likewise, the traditional concept of a positive growth regulator feedback system based on the number of surviving ovules in an ovary can account for subsequent fruit survivorship.     

Plant responses to H2S and SO2 fumigation. I. Effects on growth, transpiration and sulfur content of spinach

Exposure of spinach (Spinacia oleracea L. cv. Monosa) to 0.25 μl l_?1 H₂S reduced the relative growth rate by 26, 47 and 60% at 15, 18 and 25°C, respectively. Shoot to root ratio decreased in plants fumigated at 18 and 25°C. Growth of spinach was not affected by a 2-week exposure to 0.10 or 0.25 μl l_?1 SO₂. Both H₂S and SO₂ fumigation increased the content of sulfhydryl compounds and sulfate. A 2-week exposure to 0.25 μl l_?1 H₂S resulted in an increase in sulfhydryl and sulfate content of 250 to 450% and 63 to 248% in the shoots, respectively, depending on growth temperature. Exposure to 0.15 and 0.30 μl l_?1 H₂S at 20°C for 2 weeks resulted in a 46% increase in sulfate content of the shoots at 0.30 μl l_?1 and no detectable increase at 0.15 μl l_?1 H₂S; the sulfate content of the roots increased by 195 and 145% at 0.15 and 0.30 μl l_?1 H₂S, respectively. Fumigation with 0.25 μl l_?1 SO₂ at 20°C for 2 weeks resulted in an increase in sulfhydryl content and sulfate content in the shoots of 285% and 300 to 1100%. H₂S fumigation during the 12 h light period or only during the dark period resulted in identical growth reduction and accumulation of sulfhydryl compounds; they were about 50 and 67% of those observed in continuously exposed plants. H₂S- and SO₂-exposed plants showed an increased transpiration rate, which was mainly caused by an increased dark-period transpiration. No effect of H₂S and SO₂ on the water uptake of the plants and the osmotic potential of the leaves was detected. Plants fumigated with 0.25 μl l_?1 H₂S for 2 weeks were smaller and differed morphologically from the control plants by slightly more abaxially curved leaf margins. Cross sections of the leaves showed smaller cells at the margins and smaller and fewer air spaces. The increased transpiration in the H₂S-exposed plants is discussed in relation to the observed morphological changes.     

Coadministration of methylxanthines and inhibitor compounds potentiates teratogenicity in Xenopus embryos

Inhibitors of DNA synthesis (hydroxyurea and cytosine arabinoside), protein synthesis (cycloheximide and emetine), and nucleic acid synthesis (5-fluorouracil) were administered with each of three methylxanthines (caffeine, theophylline, and theobromine) to determine if teratogenic effects could be potentiated in Xenopus laevis embryos. The animals were exposed for 96 hours to methylxanthine and inhibitor concentrations that, alone, produced low percentages of malformations. Coadministration of caffeine or theophylline with each inhibitor greatly increased the incidence of malformed embryos. Similar potentiation was induced when theobromine and the protein synthesis inhibitors were tested. A lesser potentiative response was produced when theobromine and the nucleic acid synthesis inhibitor were administered together. Teratogenic potentiation did not occur when theobromine was administered in conjunction with the DNA synthesis inhibitors. Growth reduction in the treatments proved to be the most sensitive indicator of the potentiative effects. This study had two significant findings: the teratogenicity of the protein synthesis inhibitors was greatly increased upon coadministration with each methylxanthine, even though they are typically not very teratogenic by themselves, and coadministration of the DNA synthesis inhibitors with theobromine did not result in teratogenic potentiation. Additionally, this study serves as one method of validating the frog embryo teratogenesis assay-Xenopus (FETAX), since the results obtained concur with results from similar mammalian studies.     

Site-directed mutagenesis to determine essential residues of ribulose-bisphosphate carboxylase ofRhodospirillum rubrum

Both Lys-166 and His-291 of ribulosebisphosphate carboxylase/oxygenase fromRhodospirillum rubrum have been implicated as the active-site residue that initiates catalysis. To decide between these two candidates, we resorted to site-directed mutagenesis to replace Lys-166 and His-291 with several amino acids. All 7 of the position-166 mutants tested are severely deficient in carboxylase activity, whereas the alanine and serine mutants at position 291 are ∼40% and ∼18% as active as the native carboxylase, essentially ruling out His-291 in theRhodospirillum rubrum carboxylase (and by inference His-298 in the spinach enzyme) as a catalytically essential residue. The ability of some of the mutant proteins to undergo carbamate formation or to bind either ribulosebisphosphate or a transition-state analogue remains largely unimpaired. This implies that Lys-166 is not required for substrate binding; rather, the results corroborate the earlier postulate that Lys-166 functions as an acid-base group in catalysis or in stabilizing a transition state in the reaction pathway.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Three-dimensional structure of the large ribosomal subunit from Escherichia coli.

The three-dimensional structure of the large (50S) ribosomal subunit from Escherichia coli has been determined from electron micrographs of negatively stained specimens. A new method of three-dimensional reconstruction was used which combines many images of individual subunits recorded at a single high tilt angle. A prominent feature of the reconstruction is a large groove on the side of the subunit that interacts with the small ribosomal subunit. This feature is probably of functional significance as it includes the regions where the peptidyl transferase site and the binding locations of the elongation factors have been mapped previously by immunoelectron microscopy.     

Potassium-mediated stimulation of hepatic glycogenolysis

Increased extracellular potassium concentrations ([K+]o) stimulated transient increases in glucose release and 45Ca2+ washout in the perfused rat liver. Stimulated glucose release had a K0.5 of about 26 mM for [K+]o, was not desensitized by successive infusion intervals of increased [K+]o, was not affected by altering the direction of perfusion, was absolutely dependent on the presence of [Ca2+]o, and was blocked by 2 mM cobalt or 10 microM verapamil. The increase in 45Ca2+ washout resulting from increased [K+]o also was blocked by 2 mM cobalt or 10 microM verapamil. Inhibitors of vascular tone (nitroprusside, atriopeptin II), arachidonic acid metabolism (indomethacin, nordihydroguaiaretic acid), and alpha- or beta-adrenergic or muscarinic nerve stimulation/secretion (phentolamine, propranolol, atropine) were unable to inhibit the [K+]o-stimulated glucose release. ATP, ADP, and AMP concentrations in tissue freeze-clamped 2 min after the onset of infusion of 50 mM K+ were not significantly different from control tissue. Glucose release from freshly isolated suspensions or primary cultured monolayers of hepatocytes or from liver slices, all of which responded to glucagon or phenylephrine, did not respond to increased [K+]o. The results indicate that glycogenolysis stimulated by depolarizing gradients of K+ is dependent on an intact perfused vasculature and may be mediated by potential-sensitive Ca2+ channels present in the vascular endothelium of the liver.