Reproductive success,spontaneous embryo abortion,and genetic load in flowering plants

Summary Reproductive success is divided into two phases: preemergent (the number of viable seeds that enter the ambient environment) and postemergent (the percentage of progeny that survive to reproduce). We studied preemergent reproductive success (PERS) in flowering plants by measuring the fruit/flower (Fr/Fl) ratio and the seed/ovule (S/O) ratio in a number of species of outcrossing and inbreeding plants, where PERS=the product of (Fr/Fl) and (S/O). In order to determine the influence of the ambient environment (including resource availability) we studied pairs of outcrossing and inbreeding species occurring in the same habitat. Among outcrossing species PERS averaged about 22%, whereas in inbreeding species the average was approximately 90%. The progeny/zygote (P/Z) ratio was studied in hand-pollinated populations in Epilobium angustifolium (a strongly outcrossing species) from populations in Oregon and Utah, by direct observation of embryogenesis at twoday intervals throughout the course of seed development. The P/Z ratio in both populations averaged near 30%, and the developing embryos showed a surprising array of abnormalities that resulted in embryo death. During early development >95% of the ovules had normally developing globular embryos, but beginning with differentiation (cotyledon formation) about 70% of the original globular embryos aborted during the course of embryogenesis and seed development. The clustering of developmental lethals during peroids of major differentiation events parallels the animal model of development. We found little evidence that PERS was limited by the ambient environment (including resource availability), pollination, or factors associated with the inbreeding habit. Instead, PERS was found to be inextricably linked to outcrossing plants, whose breeding systems promote genetic variability. The high incidence of developmental lethals in E. angustifolium and the resulting low P/Z ratio (ca. 30%) is attributed to genetic load (any lethal mutation or allelic combination) possibly working in combination with developmental selection (interovarian competition among genetically diverse embryos). Examples of maternally controlled, fixed patterns of ovule abortion with respect to position or number are discussed. However, we found no need to employ female choice as a hypothesis to explain our results for the extensive, seemingly random patterns of embryo abortion in E. angustifolium and other outcrossing species. A more parsimonious, mechanistic explanation based on genetic load-developmental selection is sufficient to account for the differential survivorship of embryos. Likewise, the traditional concept of a positive growth regulator feedback system based on the number of surviving ovules in an ovary can account for subsequent fruit survivorship.     

Plant responses to H2S and SO2 fumigation. I. Effects on growth, transpiration and sulfur content of spinach

Exposure of spinach (Spinacia oleracea L. cv. Monosa) to 0.25 μl l_?1 H₂S reduced the relative growth rate by 26, 47 and 60% at 15, 18 and 25°C, respectively. Shoot to root ratio decreased in plants fumigated at 18 and 25°C. Growth of spinach was not affected by a 2-week exposure to 0.10 or 0.25 μl l_?1 SO₂. Both H₂S and SO₂ fumigation increased the content of sulfhydryl compounds and sulfate. A 2-week exposure to 0.25 μl l_?1 H₂S resulted in an increase in sulfhydryl and sulfate content of 250 to 450% and 63 to 248% in the shoots, respectively, depending on growth temperature. Exposure to 0.15 and 0.30 μl l_?1 H₂S at 20°C for 2 weeks resulted in a 46% increase in sulfate content of the shoots at 0.30 μl l_?1 and no detectable increase at 0.15 μl l_?1 H₂S; the sulfate content of the roots increased by 195 and 145% at 0.15 and 0.30 μl l_?1 H₂S, respectively. Fumigation with 0.25 μl l_?1 SO₂ at 20°C for 2 weeks resulted in an increase in sulfhydryl content and sulfate content in the shoots of 285% and 300 to 1100%. H₂S fumigation during the 12 h light period or only during the dark period resulted in identical growth reduction and accumulation of sulfhydryl compounds; they were about 50 and 67% of those observed in continuously exposed plants. H₂S- and SO₂-exposed plants showed an increased transpiration rate, which was mainly caused by an increased dark-period transpiration. No effect of H₂S and SO₂ on the water uptake of the plants and the osmotic potential of the leaves was detected. Plants fumigated with 0.25 μl l_?1 H₂S for 2 weeks were smaller and differed morphologically from the control plants by slightly more abaxially curved leaf margins. Cross sections of the leaves showed smaller cells at the margins and smaller and fewer air spaces. The increased transpiration in the H₂S-exposed plants is discussed in relation to the observed morphological changes.     

Site-directed mutagenesis to determine essential residues of ribulose-bisphosphate carboxylase ofRhodospirillum rubrum

Both Lys-166 and His-291 of ribulosebisphosphate carboxylase/oxygenase fromRhodospirillum rubrum have been implicated as the active-site residue that initiates catalysis. To decide between these two candidates, we resorted to site-directed mutagenesis to replace Lys-166 and His-291 with several amino acids. All 7 of the position-166 mutants tested are severely deficient in carboxylase activity, whereas the alanine and serine mutants at position 291 are ∼40% and ∼18% as active as the native carboxylase, essentially ruling out His-291 in theRhodospirillum rubrum carboxylase (and by inference His-298 in the spinach enzyme) as a catalytically essential residue. The ability of some of the mutant proteins to undergo carbamate formation or to bind either ribulosebisphosphate or a transition-state analogue remains largely unimpaired. This implies that Lys-166 is not required for substrate binding; rather, the results corroborate the earlier postulate that Lys-166 functions as an acid-base group in catalysis or in stabilizing a transition state in the reaction pathway.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Three-dimensional structure of the large ribosomal subunit from Escherichia coli.

The three-dimensional structure of the large (50S) ribosomal subunit from Escherichia coli has been determined from electron micrographs of negatively stained specimens. A new method of three-dimensional reconstruction was used which combines many images of individual subunits recorded at a single high tilt angle. A prominent feature of the reconstruction is a large groove on the side of the subunit that interacts with the small ribosomal subunit. This feature is probably of functional significance as it includes the regions where the peptidyl transferase site and the binding locations of the elongation factors have been mapped previously by immunoelectron microscopy.     

Ecology of bdelloids: how to be successful

Bdelloids inhabit many different environments. The entire taxon is an order belonging to the phylum Rotifera. In spite of its wide distribution, it has a very uniform morphology, suggesting that natural selection has had almost no effect on its morphological characteristics.This paper reviews the geographical and ecological distributions of bdelloids and their ability to tolerate different conditions is discussed. Two characteristics account for the wide distribution of bdelloids, parthenogenetic reproduction and their ability to withstand unfavorable conditions through anhydrobiosis. The former is an apomictic thelytoky which may ensure genetic homogeneity within clones. However, evidence which suggests variability among and within parthenogenetic clones is discussed. Some recent experimental evidence indicates that anhydrobiosis does not affect the life history of the surviving individuals. The effects of anhydrobiosis on bdelloid populations are considered.     

Membrane glycoproteins involved in neurite fasciculation

Lectin affinity chromatography combined with mAb production was used to identify chick neural cell surface molecules related to L1 antigen, a mouse neural glycoprotein implicated in cell-cell adhesion (Rathjen, F. G., and M. Schachner, 1984, EMBO (Eur. Mol. Biol. Organ.) J., 3:1-10). A glycoprotein, G4 antigen, isolated by mAb G4 from adult chick brain is described which comprises a major 135-kD component, a minor doublet at 190 kD, and diffusely migrating bands at 80 and 65 kD in SDS PAGE. This molecule is structurally related to mouse L1 antigen according to NH2-terminal amino acid sequence (50% identity) as well as the behavior of its components in two-dimensional IEF/SDS PAGE gels. A second chicken glycoprotein, F11 antigen, was isolated from adult chick brain using mAb F11. This protein has also a major 135-kD component and minor components at 170 kD and 120 kD. Both immunotransfer analysis with polyclonal antibodies to mAb G4 and to mAb F11 isolate and the behavior on IEF/SDS PAGE gels indicates that the major 135-kD component of F11 antigen is distinct from G4 antigen components. However, the 135-kD component of F11 antigen shares with G4 antigen and the neural cell adhesion molecule (NCAM) the HNK-1/L2 carbohydrate epitope. In immunofluorescence studies, G4 and F11 antigenic sites were found to be associated mainly with the surface of process-bearing cells, particularly in fiber-rich regions of embryonic brain. Although Fab fragments of polyclonal antibodies to mAbs G4 or F11 immunoaffinity isolate only weakly inhibit the Ca2+-independent aggregation of neural cells, they strongly inhibit fasciculation of retinal axons. Together these studies extend the evidence that bundling of axons reflects the combined effects of a group of distinct cell surface glycoproteins.     

Cartilage electromechanics--II. A continuum model of cartilage electrokinetics and correlation with experiments

We have formulated a continuum model for linear electrokinetic transduction in cartilage. Expressions are derived for the streaming potential and streaming current induced by oscillatory, uniaxial confined compression of the tissue, as well as the mechanical stress generated by a current density or potential difference applied to the tissue. The experimentally observed streaming potential and current-generated stress response, measured on the same specimens, are compared with the predictions of the theory over a wide frequency range. The theory compares well with the data for reasonable values of cartilage intrinsic mechanical parameters and electrokinetic coupling coefficients. Experiments also show a linear relationship between the stimulus amplitude and the transduction response amplitude, within the range of stimulus amplitudes of interest. This observation is shown to be consistent with the predictions of the linear theory.