Male mice produced by in vitro culture have reduced fertility and transmit organomegaly and glucose intolerance to their male offspring

It has been reported that suboptimal in vitro culture (IVC) of mouse embryos can affect the postnatal expression of epigenetically sensitive alleles, resulting in altered postnatal growth, organ dimensions, health, and behavior in the offspring. Although these detrimental impacts on the offspring are well described, the relative contribution of the IVC-produced fathers is unclear. In this work, we have analyzed if suboptimal IVC (achieved by altering the culture medium by the addition of FCS) can affect male fertility and if organ size and glucose clearance, two of the adverse effects produced by suboptimal IVC conditions, were transmitted to the next two generations. IVC-produced males had lower sperm concentrations (5.8 × 10(6) spermatozoa in IVC vs. 14.5 × 10(6) spermatozoa in control), and these sperm exhibited decreased overall motility (49.6% vs. 72.8% in control) and progressive motility (22.6% vs. 32.2% in control). Fertility tests demonstrated that the percentage of pregnancies was reduced for IVC males (35% for IVC-produced males vs. 86% for in vivo controls). These features were related to a modified gene expression pattern in adult male testes, showing an altered gene expression in genes involved in DNA repair and apoptosis that was confirmed by TUNEL assay. Regarding the IVC related adverse phenotype transmitted to offspring, male glucose intolerance was shown only in F1 and F2 male but not female offspring. The same occurred with male abnormalities in the organ size of the liver, which were transmitted to F1 and F2 males but not to F1 females; moreover, analysis of the F0, F1, and F2 males revealed greater coefficients of variance in body weight and glucose intolerance than the control group. Finally, we analyzed, through gene silencing, the effect of IVC on the mRNA expression at the blastocyst stage for 11 known gene expression modifiers of epigenetic reprogramming. Suboptimal IVC reduced the expression of Kap1, Sox2, Hdac1, Dnmt1, and Dnmt3a, suggesting a molecular epigenetic role for gene expression modifiers in the origin and transmission of these abnormal phenotypes.     

Application of Multi-SNP Approaches Bayesian LASSO and AUC-RF to Detect Main Effects of Inflammatory-Gene Variants Associated with Bladder Cancer Risk

The relationship between inflammation and cancer is well established in several tumor types, including bladder cancer. We performed an association study between 886 inflammatory-gene variants and bladder cancer risk in 1,047 cases and 988 controls from the Spanish Bladder Cancer (SBC)/EPICURO Study. A preliminary exploration with the widely used univariate logistic regression approach did not identify any significant SNP after correcting for multiple testing. We further applied two more comprehensive methods to capture the complexity of bladder cancer genetic susceptibility: Bayesian Threshold LASSO (BTL), a regularized regression method, and AUC-Random Forest, a machine-learning algorithm. Both approaches explore the joint effect of markers. BTL analysis identified a signature of 37 SNPs in 34 genes showing an association with bladder cancer. AUC-RF detected an optimal predictive subset of 56 SNPs. 13 SNPs were identified by both methods in the total population. Using resources from the Texas Bladder Cancer study we were able to replicate 30% of the SNPs assessed. The associations between inflammatory SNPs and bladder cancer were reexamined among non-smokers to eliminate the effect of tobacco, one of the strongest and most prevalent environmental risk factor for this tumor. A 9 SNP-signature was detected by BTL. Here we report, for the first time, a set of SNP in inflammatory genes jointly associated with bladder cancer risk. These results highlight the importance of the complex structure of genetic susceptibility associated with cancer risk.     

Identification of a Vitamin D response element in the human insulin receptor gene promoter

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.     

Body configuration as a predictor of mortality: comparison of five anthropometric measures in a 12 year follow-up of the Norwegian HUNT 2 study

Background

Distribution of body fat is more important than the amount of fat as a prognostic factor for life expectancy. Despite that, body mass index (BMI) still holds its status as the most used indicator of obesity in clinical work.

Methods

We assessed the association of five different anthropometric measures with mortality in general and cardiovascular disease (CVD) mortality in particular using Cox proportional hazards models. Predictive properties were compared by computing integrated discrimination improvement and net reclassification improvement for two different prediction models. The measures studied were BMI, waist circumference, hip circumference, waist-to-hip ratio (WHR), and waist-to-height ratio (WHtR). The study population was a prospective cohort of 62,223 Norwegians, age 20–79, followed up for mortality from 1995–1997 to the end of 2008 (mean follow-up 12.0 years) in the Nord-Trøndelag Health Study (HUNT 2).

Results

After adjusting for age, smoking and physical activity WHR and WHtR were found to be the strongest predictors of death. Hazard ratios (HRs) for CVD mortality per increase in WHR of one standard deviation were 1.23 for men and 1.27 for women. For WHtR, these HRs were 1.24 for men and 1.23 for women. WHR offered the greatest integrated discrimination improvement to the prediction models studied, followed by WHtR and waist circumference. Hip circumference was in strong inverse association with mortality when adjusting for waist circumference. In all analyses, BMI had weaker association with mortality than three of the other four measures studied.

Conclusions

Our study adds further knowledge to the evidence that BMI is not the most appropriate measure of obesity in everyday clinical practice. WHR can reliably be measured and is as easy to calculate as BMI and is currently better documented than WHtR. It appears reasonable to recommend WHR as the primary measure of body composition and obesity.     

Characterization of TioQ, a type II thioesterase from the thiocoraline biosynthetic cluster

An antitumor agent thiocoraline is a thiodepsipeptide marine product derived from two Micromonospora sp. strains that inhibits protein synthesis by binding of its key 3-hydroxyquinaldic acid (3HQA) chromophores to duplex DNA. There are at least two potential pathways via which the 3HQA moiety could be biosynthesized from L-Trp. By biochemical characterization and by preparation of knockouts of an adenylation-thiolation enzyme, TioK, and of two type II thioesterases, TioP and TioQ, found in the thiocoraline biosynthetic gene cluster, we gained valuable insight into the pathway followed for the production of 3HQA.     

Long-term and transgenerational effects of in vitro culture on mouse embryos

The mouse is a convenient model to analyze the impact of in vitro culture (IVC) on the long-term health and physiology of the offspring, and the possible inheritance of these altered phenotypes. The preimplantation period of mammalian development has been identified as an early ‘developmental window’ during which environmental conditions may influence the pattern of future growth and physiology. Suboptimal culture media can cause severe alterations in mRNA expression in the embryo, which are associated with embryo quality reduction. In addition, the embryonic epigenetic reprogramming may also be severely affected by IVC, modifying epigenetic marks particularly in imprinted genes and epigenetically sensitive alleles. These altered epigenetic marks can persist after birth, resulting in adult health problems such as obesity, increased anxiety and memory deficits. Furthermore, some epigenetic modifications have been found to be transmitted to the offspring (epigenetic transgenerational inheritance), thereby providing a suitable model to asses risks of cross-generational effects of perturbing early embryo development. This review will highlight how preimplantation environment changes can not only affect developmental processes taking place at that time, but can also have an impact further, affecting offspring health and physiology; and how they may be transmitted to the next generation. We will also analyze the emerging role of epigenetics as a mechanistic link between the early environment and the later phenotype of the developing organism.     

An Artificial Aril Designed to Induce Seed Hauling by Ants for Ecological Rehabilitation Purposes

Ants are effective at moving seeds toward their nests, something that may benefit the seeds. We evaluated whether seed movements that may be useful for the rehabilitation of degraded pastures in Colombia can be enhanced by local ants. An artificial aril was prepared and then evaluated in six open cattle pasture farms. Twenty paper disks (each holding seeds with an artificial aril, honey, tuna oil, and control) were set up along linear transects at each farm, and monitored five times in 48 hours. A total of 340 out of 480 seeds were moved from the experimental units by ants. Seeds with tuna oil and an artificial aril were removed twice as frequently as the control and honey smeared seeds. Ectatomma ruidum, Solenopsis geminata, and Pheidole sp. removed the majority of seeds. Advantages of the artificial aril over tuna oil are discussed. This inexpensive technique can enhance seed movement by generalist ants in degraded pastures, likely contributing to regeneration and ecological rehabilitation.     

Decline in local ecological knowledge in the Colombian Andes may constrain silvopastoral tree diversity

Local ecological knowledge (LEK) can play an important role in ecological restoration by guiding landholder decision‐making towards more ecologically oriented land management. Silvopastures are a promising option for restoring ecological function to degraded landscapes because they increase tree cover and diversity, moderating the impacts of cattle production on ecological processes. Some silvopastoralists possess considerable LEK that can shape silvopastoral tree communities, but little is known about the temporal trends of this knowledge base. We followed up on a survey of workers, managers, and owners of silvopastoral farms in the Colombian Andes 6 years later and found that the ability to identify native trees and describe their uses, and interest in tree planting, were significantly lower. Importantly, the likelihood that an individual would plant a species was linked directly to the number of uses they listed for that species. Furthermore, the utility of species became more important for influencing the probability of planting native trees over time, as general interest in planting trees declined. We show that knowledge about the uses of native trees is critical for promoting cultivation of diverse tree species in silvopastoral systems, and that multipurpose trees are most likely to be planted. Moreover, our results suggest that the socio‐economic changes driving declines in ecological knowledge elsewhere, including outmigration and limited transmission of knowledge to younger generations, appear to erode LEK among Colombian silvopastoralists. Preserving LEK is therefore a critical factor for ensuring silvopastoral and other agro‐ecosystems can contribute to efforts to restore ecological integrity to degraded landscapes.