A vector for sequencing long (40-kb) DNA fragments

An improved vector (pAA113M) has been constructed for sequencing long (40-kb) DNA fragments. The DNA fragment is cloned in the tet gene of the cosmid and subdivided into numerous overlapping segments by IS1-promoted deletions. Plasmids bearing these deletions are fractionated by gel electrophoresis, and shortened further from the opposite end by treatment with specific restriction endonucleases. Thus, a series of short overlapping segments, spread across the entire length of the fragment, become fused to IS1. Each segment can then be sequenced by the dideoxy method using an IS1 primer. The plasmids can replicate either from their normal origin or, in the presence of a filamentous helper phage, from the M13 origin. Hence, each segment can be sequenced as either double-stranded DNA or single-stranded DNA. Sequences of IS1-promoted and restriction enzyme-generated deletions contain overlaps that can be used to assemble the complete 40-kb sequence.     

Dideoxy sequencing of double-stranded DNA from poly(A)-extended 3'-ends

A simple method has been developed for sequencing double-stranded DNA by the chain termination method. The DNA to be sequenced is cut with a restriction enzyme that leaves a 3'-overhang which is extended by terminal deoxynucleotidyltransferase with limiting amounts of dATP. The sequencing reaction is then primed with an oligo(dT) primer which has a base pair "anchor" complementary to the overhang generated by the restriction enzyme. The method presented here eliminates the need for subcloning of the DNA or sequencing by chemical modification. Furthermore, sequences of more than 300 nucleotides are obtained from any 3'-overhanging restriction end.     

Endonuclease-mediated long PCR and its application to restriction mapping

The polymerase chain reaction (PCR) is the most widely used technique for the study of DNA. Applications for PCR have been extended significantly by the development of "long" PCR, a technique that makes it possible to amplify DNA fragments up to 40 kb in length. This article describes two novel applications of the long PCR technique, one which simplifies restriction mapping and another which enhances amplification specificity and yield. The same primers used to perform the long PCR amplification can be used as probes to perform restriction mapping of the DNA fragment amplified. Restriction digestion performed prior to long PCR amplification can be used to selectively suppress the amplification of members of families of closely related DNA sequences, thereby making it possible to selectively amplify one of a group of highly homologous sequences. These two complimentary techniques, both involving use of the long PCR paired with restriction digestion, have potential application in any laboratory in which PCR is performed.     

Ordered deletions for DNA sequencing and in vitro mutagenesis by polymerase extension and exonuclease III gapping of circular templates.

A simple method is described for generating nested deletions from any fixed point in a cloned inset. Starting with a single-stranded phagemid template, T4 DNA polymerase is used to extend an annealed primer. This leads to a fully double-stranded circular molecule with a nick or small gap just 5' to the primer. Exonuclease III initiates progressive digestion from the resulting 3' end. Removal of timed aliquots and digestion with a single-strand specific endonuclease leads to a series of linear nested fragments having a common end corresponding to the 5' end of the primer. These molecules are circularized and used to transform cells, providing large numbers of deletion clones with targeted breakpoints. The 6-step procedure involves successive additions to tubes, beginning with a single-stranded template and ending with transformation; no extractions, precipitations or centrifugations are needed. Results are comparable to those obtained with standard Exonuclease III-generated deletion protocols, but there is no requirement for restriction endonuclease digestion or for highly purified double-stranded DNA starting material. This procedure provides a strategy for obtaining nested deletions in either direction both for DNA sequencing and for functional analysis.     

Universal TA cloning

TA cloning is one of the simplest and most efficient methods for the cloning of PCR products. The procedure exploits the terminal transferase activity of certain thermophilic DNA polymerases, including Thermus aquaticus (Taq) polymerase. Taq polymerase has non-template dependent activity which preferentially adds a single adenosine to the 3'-ends of a double stranded DNA molecule, and thus most of the molecules PCR amplified by Taq polymerase possess single 3'-A overhangs. The use of a linearized "T-vector" which has single 3'-T overhangs on both ends allows direct, high-efficiency cloning of PCR products, facilitated by complementarity between the PCR product 3'-A overhangs and vector 3'-T overhangs. The TA cloning method can be easily modified so that the same T-vector can be used to clone any double-stranded DNA fragment, including PCR products amplified by any DNA polymerase, as well as all blunt- and sticky-ended DNA species. This technique is especially useful when compatible restriction sites are not available for the subcloning of DNA fragments from one vector to another. Directional cloning is made possible by appropriate hemi-phosphorylation of both the T-vectors and the inserts. With a single T-vector at hand, any DNA fragment can be cloned without compromising the cloning efficiency. The universal TA cloning method is thus both convenient and labor-saving.     

A new method for constructing NotI linking and boundary libraries using a restriction trapper.

We have developed a novel method for constructing NotI linking and boundary libraries using a modified "solid-supported ligation primer" (restriction trapper). The restriction trapper could be used to purify the DNA fragments with a specific restriction enzyme cutting site(s) at their ends. The method uses a ligation and recutting reaction with double-stranded DNA ends of a hairpin-shaped oligolinker which is connected covalently to the surface of the latex beads. Selectivity is based on the specificity of the restriction enzyme for its recognition site, resulting in efficient purification. We applied this technique to the construction of high-quality NotI linking and NotI boundary libraries, which contain almost all the NotI sites of the genome and, in addition, are free of illegitimately ligated clones.     

Size fractionation of DNA fragments by liquid-liquid chromatography

A method for the fractionation of double-stranded DNA fragments from 150 to 22000 b.p. in size by liquid-liquid chromatography is described. The procedure makes use of the fact that the partitioning of DNA in a polyethylene glycol-dextran system is size dependent and can be altered by alkali metal cations. Cellulose or celite are used as supports for the stationary, dextran-rich phase. Examples show the fractionation of digests of T7 DNA produced by Dpn II and Hind II restriction endonulceases as well as lambda DNA digests produced by Hind III and Eco RI restriction endonucleases.     

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.     

Assembly of genes from partially overlapping fragments using single-stranded DNA and sequence-specific synthetic oligodeoxynucleotides

A simple procedure for the precise assembly of functional DNA sequences from overlapping fragments is described. The fragments to be joined are cloned in tandem in the proper relative orientation into a vector from which single-stranded DNA copies can be obtained. Single-stranded DNA is cut by a restriction enzyme at corresponding sites in the two overlap regions, which are made double-stranded by annealing an oligonucleotide of appropriate sequence to them. This results in the excision of the unwanted sequences between the two overlap regions. After removal of the restriction enzyme the DNA is reannealed using the same oligonucleotide, ligated to give closed circular molecules and used to transform competent cells. Clones with the desired structure appear in the progeny at high frequency. The method has the advantage that restriction enzymes with short recognition sequences, cutting frequently in the target DNA, can be used and hence the overlap region required can be quite short.     

Rapid and reliable fluorescent cycle sequencing of double-stranded templates.

Automated DNA sequencing is an extremely valuable technique which requires very high quality DNA templates to be carried out successfully. While it has been possible to readily produce large numbers of such templates from M13 or other single-stranded vectors for several years, the sequencing of double-stranded DNA templates using the ABI 373 DNA Sequencer has had a considerably lower success rate. We describe how the combination of a new fluorescent, dideoxy sequencing method, called cycle-sequencing, coupled with modifications to template isolation procedures based on Qiagen columns, makes fluorescent sequencing of double-stranded templates a reliable procedure. From a single five milliliter culture enough DNA can be isolated (up to 20 micrograms) to do 4-8 sequencing reactions, each of which yields 400-500 bases of high quality sequence data. These procedures make the routine use of double-stranded DNA templates a viable strategy in automated DNA sequencing projects.     

Codon cassette mutagenesis: a general method to insert or replace individual codons by using universal mutagenic cassettes.

We describe codon cassette mutagenesis, a simple method of mutagenesis that uses universal mutagenic cassettes to deposit single codons at specific sites in double-stranded DNA. A target molecule is first constructed that contains a blunt, double-strand break at the site targeted for mutagenesis. A double-stranded mutagenic codon cassette is then inserted at the target site. Each mutagenic codon cassette contains a three base pair direct terminal repeat and two head-to-head recognition sequences for the restriction endonuclease Sapl, an enzyme that cleaves outside of its recognition sequence. The intermediate molecule containing the mutagenic cassette is then digested with Sapl, thereby removing most of the mutagenic cassette, leaving only a three base cohesive overhang that is ligated to generate the final insertion or substitution mutation. A general method for constructing blunt-end target molecules suitable for this approach is also described. Because the mutagenic cassette is excised during this procedure and alters the target only by introducing the desired mutation, the same cassette can be used to introduce a particular codon at all target sites. Each cassette can deposit two different codons, depending on the orientation in which it is inserted into the target molecule. Therefore, a series of eleven cassettes is sufficient to insert all possible amino acids at any constructed target site. Thus codon cassettes are 'off-the-shelf' reagents, and this methodology should be a particularly useful and inexpensive approach for subjecting multiple different positions in a protein sequence to saturation mutagenesis.     

Site-directed mutagenesis of virtually any plasmid by eliminating a unique site.

We describe an efficient site-specific mutagenesis procedure that is effective with virtually any plasmid, requiring only that the target plasmid carry a unique, nonessential restriction site. The procedure employs two mutagenic oligonucleotide primers. One primer contains the desired mutation and the second contains a mutation in any unique, nonessential restriction site. The two primers are annealed to circular single-stranded DNA (produced by heating circular double-stranded DNA) and direct synthesis of a new second strand containing both primers. The resulting DNA is transformed into a mismatch repair defective (mut S) Escherichia coli strain, which increases the probability that the two mutations will cosegregate during the first round of DNA replication. Transformants are selected en masse in liquid medium containing an appropriate antibiotic and plasmid DNA is prepared, treated with the enzyme that recognizes the unique, nonessential restriction site, and retransformed into an appropriate host. Linearized parental molecules transform bacteria inefficiently. Plasmids with mutations in the unique restriction site are resistant to digestion, remain circular, and transform bacteria efficiently. By linking a selectable mutation in a unique restriction site to a nonselectable mutation, the latter can be recovered at frequencies of about 80%. Since most plasmids share common vector sequences, few primers, targeted to shared restriction sites, are needed for mutagenizing virtually any plasmid. The procedure employs simple procedures, common materials, and it can be performed in as little as 2 days.     

A simple procedure for maximum yield of high-quality plasmid DNA

We have established a simple procedure for the rapid isolation of high-quality plasmid DNA suitable for various molecular techniques and provided a step-by-step protocol. The DNA samples isolated by this procedure have been used successfully for double-stranded DNA sequencing, restriction enzyme mapping, subcloning, in vitro mutagenesis, generation of deletion clones and so on. The procedure is highly reproducible, and superior quality DNA can be obtained without the use of phenol, chloroform or other organic solvents.     

Parallel assembly for multiple site-directed mutagenesis of plasmids

A parallel assembly method for multiple site-directed mutagenesis of plasmids was developed here based on Golden Gate cloning. It takes advantage of type IIs restriction enzymes and T4 DNA ligase to assemble multiple DNA fragments into a plasmid by a defined order. This method can accommodate multiple plasmid mutagenesis at any desired position with all three sequence modification types (substitution, deletion, and insertion) simultaneously. Furthermore, it can be used to create otherwise difficult-to-make mutants-larger deletions and insertions and mutagenesis on larger plasmids. The processes of mutagenesis can be completed quickly by a single restriction-ligation reaction.     

A fluorimetric assay for on-line detection of DNA cleavage by restriction endonucleases

We have developed an assay for online detection of DNA cleavage by restriction endonucleases, suitable for the high throughput screening of the activity and flanking sequence preference of restriction endonuclease variants. For this purpose oligodeoxynucleotides were used, labeled with either 6-FAM or TAMRA whose fluorescence is quenched by a neighboring DABCYL group. After endonucleolytic cleavage the products are too short to remain double-stranded and the fluorophor labeled strand is released with concomitant increase in fluorescence which can be easily quantified. Employing this method, cleavage reactions can be monitored continuously, allowing for fast detection of specific activity as well as determination of kinetic parameters. To demonstrate the reliability of our assay we measured K(M) and k(cat) values for the restriction endonuclease EcoRV and obtained results similar to those obtained with established assays. Moreover, our method makes it possible to observe the cleavage of two different substrates differing in the sequences flanking the EcoRV site and labeled with different fluorophors in competition in a single experiment. This assay can be carried out in a microplate format, which allows for the analysis of many restriction endonuclease variants in parallel.     

Multi-priming sequencing: a DNA sequencing method involving restriction enzyme-digested DNA fragments as primers.

An improved strategy for fluorescence-labeled dideoxy chain termination sequencing involving restriction enzyme-digested DNA fragments as primers, which are prepared from the DNA to be sequenced, is described. By using modified nucleoside triphosphates for strand protection in chain termination reactions, newly synthesized chains were detached from a primer at the regenerated recognition site by means of suitable restriction enzyme digestion. The digests could be analyzed with commercial automated DNA sequencers. Thus, by using restriction DNA fragments (double-stranded) as primers, sequence information was obtained from both "minus" and "plus" single-stranded DNA templates without subcloning. Nor is the synthesis of oligonucleotide primers needed. This method, named "Multi-Priming Sequencing," was proven to be time-saving, economical, and effective compared to conventional methods.     

In vitro synthesis of double-stranded DNA from the Kilham rat virus single-stranded DNA genome.

Double-stranded, full-length linear DNA was synthesized in vitro by using single-stranded linear DNA as a self-priming template from the parvovirus Kilham rat virus and Escherichia coli DNA polymerase "large fragment" as the polymerizing enzyme. To ascertain the order of the synthesis of the cleavage fragments and to assess the accuracy of the in vitro synthesis, restriction endonuclease cleavage sites with known recognition sequences were mapped on the DNA. Comparing the cleavage pattern of the synthesized DNA with that of double-stranded viral DNA isolated from infected cells confirms that the in vitro synthesis produces a faithful copy of the viral single-stranded genome. Electron micrographs of the in vitro product reveal it to be a double-stranded linear molecule.     

Seamless gene engineering using RNA- and DNA-overhang cloning

Here we describe two methods for generating DNA fragments with single-stranded overhangs, like those generated by the activity of many restriction enzymes, by simple methods that do not involve DNA digestion. The methods, RNA-overhang cloning (ROC) and DNA-overhang cloning (DOC), generate polymerase chain reaction (PCR) products composed of double-stranded (ds) DNA flanked by single-stranded (ss) RNA or DNA overhangs. The overhangs can be used to recombine DNA fragments at any sequence location, creating "perfect" chimeric genes composed of DNA fragments that have been joined without the insertion, deletion, or alteration of even a single base pair. The ROC method entails using PCR primers that contain regions of RNA sequence that cannot be copied by certain thermostable DNA polymerases. Using such a chimeric primer in PCR would yield a product with a 5' overhang identical to the sequence of the RNA component of the primer, which can be used for directional ligation of the amplified product to other preselected DNA molecules. This method provides complete control over both the length and sequence of the overhangs, and eliminates the need for restriction enzymes as tools for gene engineering.     

Isolation of C. elegans deletion mutants following ENU mutagenesis and thermostable restriction enzyme PCR screening

The ability to generate null mutants is essential for studying gene function. Gene knockouts in Caenorhabditis elegans can be generated in a high throughput manner using chemical mutagenesis followed by polymerase chain reaction (PCR) assays to detect deletions in a gene of interest. However, current methods for identifying deletions are time and labor intensive and are unable to efficiently detect small deletions. In this study, we expanded the method pioneered by Wei et al., which used the thermostable restriction enzyme PspGI and tested the usefulness of other thermostable restriction enzymes including BstUI, Tsp45I, ApeKI, and TfiI. We designed primers to flank one or multiple thermostable restriction enzymes sites in the genes of interest. The use of multiple enzymes and the optimization of PCR primer design enabled us to isolate deletion in 66.7% of the genes screened. The size of the deletions varied from 330 bp to 1 kb. This method should make it possible for small academic laboratories to rapidly isolate deletions in their genes of interest.