Examination of protein sequence homologies: III. Ribosomal protein YS25 fromSaccharomyces cerevisiae and its counterparts fromSchizosaccharomyces pombe,rat liver,andEscherichia coli

Summary The sequences of the ribosomal proteins YS25, SP-S28, RL-S21, and Ec-S6, fromSaccharomyces cerevisiae, Schizosaccharomyces pombe, rat liver, andEscherichia coli, respectively, have been examined using a computer program that searches for homologous tertiary structures. Matrices of comparisons among the eukaryotic sequences show that they match each other sequentially without any internal gaps. The average values of the correlation coefficients obtained from the comparison matrices are higher for the first halves of the sequences than for the latter halves. This result suggests that the first halves of the sequences may represent a more important domain than the latter halves. The comparison matrices between the eukaryotic and bacterial sequences of ribosomal proteins, however, do not show sequentially arranged homology, though there are six well-matching segments arranged in different orders in the two types of sequences. This implies that the eukaryotic sequences of the ribosomal protein were reconstituted by two internal transpositions and six deletions of 4–12 residues each from the ancestral sequence during the divergence between bacterial and eukaryotic genes. These findings may give insight into structural and quantitative studies of evolutionary divergence between eukaryotes and prokaryotes.     

History assignment: when was the mitochondrion founded?

The near simultaneous radiation of the major eukaryotic evolutionary assemblages — plants, animals, fungi, and at least three other complex protist assemblages worthy of ‘kingdom level’ status — was preceded by the divergence of many independent protist lineages. The earliest branches are represented by organisms that do not contain mitochondria or plastids, suggesting that the primitive eukaryotic state did not include these organelles. New information about nuclear-coded proteins that localize in the mitochondrion, however, suggests that the ancestral symbionts for mitochondria were present in the first eukaryotes. Phylogenetic support for this hypothesis is persuasive but it is not possible to account for the relative times of divergence for mitochondria and their ancestral symbionts relative to eukaryotic branching patterns inferred from nuclear genes.     

The Drosophila melanogaster RPS17 gene encoding ribosomal protein S17

A human ribosomal protein S17 cDNA [Chen et al., Proc. Natl. Acad. Sci. USA 83 (1986) 6907-6911] was used as heterologous probe to isolate S17 clones from Drosophila genomic and cDNA recombinant libraries. Five S17 genomic clones were recognized; all contained overlapping regions of a single chromosomal site. Subsequently the Drosophila RPS17 gene was mapped by in situ hybridization to chromosome 3L, band 67B1-5. The locus spans approximately 1000 bp of DNA and includes four exons. It is preceded by conventional CAAT and TATA RNA polymerase II promoter motifs. The 131 amino acid protein encoded within Drosophila RPS17 is similar to ribosomal proteins from several other eukaryotes. Comparison of eukaryotic S17 proteins' primary structures as well as the number and location of their genes' intervening sequences suggest that S17 is a relatively recent addition to the ribosomal protein family, probably post-dating divergence of eukaryotes and prokaryotes.     

Uncovering Cryptic Diversity in Two Amoebozoan Species Using Complete Mitochondrial Genome Sequences

The Amoebozoa are a major eukaryotic lineage that encompasses a wide range of amoeboid organisms. The group is understudied from a systematic perspective: molecular tools have only been applied in the last 15 yr. Hence, there is an undersampling of both genes and taxa in the group especially compared to plants, animals, and fungi. Here, we present the complete mitochondrial genomes of two ubiquitous and abundant morpho‐species (Acanthamoeba castellanii and Vermamoeba vermiformis). Both have mitochondrial genomes of close relatives previously available, enabling insights into recent divergences at a genomic scale, while simultaneously offering comparisons with divergence estimates obtained from traditionally used single genes, SSU rDNA and cox1. The newly sequenced mt genomes are significantly divergent from their previously sequenced conspecifics (A. castellannii 16.4% divergence at nucleotide level and 10.4% amino acid; V. vermiformis 21.6% and 13.1%, respectively), while divergence at the small subunit ribosomal DNA is below 1% within both species. Morphological analyses determined that these lineages are indistinguishable from their previously sequenced counterparts. Phylogenetic reconstructions using 26 mt genes also indicate a level of divergence that is comparable to divergence among species, while reconstructions using the small subunit ribosomal DNA (SSU rDNA) do not. In addition, we demonstrate that between closely related taxa, there are high levels of synteny, which can be explored for primer design to obtain larger fragments than the traditional barcoding genes. We conclude that, although most systematic work has relied on SSU, this gene alone can severely underestimate diversity. Thus, we suggest that the mt genome emerges as an alternative for unraveling the lower level phylogenetic relationships of Amoebozoa.     

PHYLOGENY OF GRACILARIA LEMANEIFORMIS (RHODOPHYTA) BASED ON SEQUENCE ANALYSIS OF ITS SMALL SUBUNIT RIBOSOMAL RNA CODING REGION1

The small subunit ribosomal RNA (rRNA) sequence of Gracilaria lemaneiformis Bory Weber-van Bosse was inferred from analysis of rRNA coding regions that were amplified by the polymerase chain reaction method. Comparison of the G. lemaneiformis small subunit rRNA to homologous genes of diverse eukaryotes demonstrated that the red algal divergence was nearly simultaneous with the separation of plants, fungi, animals and many other protist lineages. This result conflicts with those of 5S rRNA sequence and plastid based phytogenies which suggest that red algae represent an early divergence in the eukaryotic line of descent. Further, algae appear to be of polyphyletic origin and red algae are unrelated to higher fungi.     

The genome reduction hypothesis and the phylogeny of eukaryotes

The first steps in eukaryotic evolution appear difficult to retrace despite the availability of an increasing amount of data. Current molecular phylogenies suggest that the eukaryotic tree would be better represented as a bush of major lineages whose order of emerge is poorly resolved. Such lack of resolution is often explained by a radiation event that would have left very little ancient signal in eukaryotic molecular markers. We suggest a complementary genomic approach that might help tackling this major issue. It rests on a hypothesis, the genome reduction hypothesis (GRH), suggesting that the divergence of major eukaryotic lineages might have been coupled with independent genomic reduction events, starting from a large and partially redundant chimerical genome. Thus, significant and coherent patterns of shared ancestral gene losses between major eukaryotic lineages might help polarizing the most basal nodes in the eukaryotic phylogeny. We propose a test for the GRH that exploits the increasing availability of complete eukaryotic genomes in public databases.     

Molecular phylogeny of the free-living archezoanTrepomonas agilis and the nature of the first eukaryote

We have sequenced the small ribosomal subunit RNA gene of the diplozoanTrepomonas agilis. This provides the first molecular information on a free-living archezoan. We have performed a phylogenetic analysis by maximum likelihood, parsimony, and distance methods for all available nearly complete archezoan small subunit ribosomal RNA genes and for representatives of all major groups of more advanced eukaryotes (metakaryotes). These show Diplozoa as the earliest-diverging eukaryotic lineage, closely followed by microsporidia.Trepomonas proves to be much more closely related toHexamita, and, to a lesser degree, toSpironucleus, than toGiardia. The close relationship between the free-livingTrepomonas on our trees and the parasitesHexamita inflata andSpironucleus refutes the idea that the early divergence of the amitochondrial Archezoa is an artefact caused by parasitism. The deep molecular divergence between the three phagotrophic genera with two cytostomes (Hexamita, Trepomonas, Spironucleus) and the saprotrophicGiardia that lacks cytostomes is in keeping with the classical evidence for a fundamental difference in the symmetry of the cytoskeleton between the two groups. We accordingly separate the two groups as two orders: Distomatida for those with two cytostomes/cytopharynxes and Giardiida ord. nov. forGiardia andOctomitus that lack these, and divide each order into two families. We suggest that this fundamental divergence in manner of feeding and in the symmetry of the cytoskeleton evolved in a free-living diplozoan very early indeed in the evolution of the eukaryotic cell, possibly very soon after the origin of the diplokaryotic state (having two nuclei linked together firmly by the cytoskeleton) and before the evolution of parasitism by distomatids and giardiids, which may have colonized animal guts independently. We discuss the possible relationship between the two archezoan phyla (Metamonada and Microsporidia) and the nature of the first eukaryotic cell in the light of our results and other recent molecular data.     

Phylogenetic analysis of five medically important Candida species as deduced on the basis of small ribosomal subunit RNA sequences.

The classification of species belonging to the genus Candida Berkhout is problematic. Therefore, we have determined the small ribosomal subunit RNA (srRNA) sequences of the type strains of three human pathogenic Candida species; Candida krusei, C. lusitaniae and C. tropicalis. The srRNA sequences were aligned with published eukaryotic srRNA sequences and evolutionary trees were inferred using a matrix optimization method. An evolutionary tree comprising all available eukaryotic srRNA sequences, including two other pathogenic Candida species, C. albicans and C. glabrata, showed that the yeasts diverge rather late in the course of eukaryote evolution, namely at the same depth as green plants, ciliates and some smaller taxa. The cluster of the higher fungi consists of 10 ascomycetes and ascomycete-like species with the first branches leading to Neurospora crassa, Pneumocystis carinii, Candida lusitaniae and C. krusei, in that order. Next there is a dichotomous divergence leading to a group consisting of Torulaspora delbrueckii, Saccharomyces cerevisiae, C. glabrata and Kluyveromyces lactis and a smaller group comprising C. tropicalis and C. albicans. The divergence pattern obtained on the basis of srRNA sequence data is also compared to various other chemotaxonomic data.     

Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.     

Sequence of an acidic ribosomal protein from the jellyfish Polyorchis penicillatus

We have isolated a cDNA clone from the jellyfish Polyorchis penicillatus that encodes the homologue of the A1 acidic ribosomal protein previously characterized in human, brine shrimp, fruit fly, and yeast. The sequence of this protein is strongly conserved among the five eukaryotic species for which it has been determined. Conservation is greatest in the amino-terminal 51 amino acids and the carboxyl-terminal 25 amino acids. This suggests that these regions are necessary for interactions with other components of the protein synthetic machinery, while the central part of the protein has a less specific role to play. Comparison of the sequences obtained from the different species indicate that the metazoan lineages all appear to have arisen at approximately the same time and significantly later than the time of divergence of yeast from the common ancestor of the Metazoa.     

Eukaryotic organisms in Proterozoic oceans

The geological record of protists begins well before the Ediacaran and Cambrian diversification of animals, but the antiquity of that history, its reliability as a chronicle of evolution and the causal inferences that can be drawn from it remain subjects of debate. Well-preserved protists are known from a relatively small number of Proterozoic formations, but taphonomic considerations suggest that they capture at least broad aspects of early eukaryotic evolution. A modest diversity of problematic, possibly stem group protists occurs in ca 1800-1300 Myr old rocks. 1300-720 Myr fossils document the divergence of major eukaryotic clades, but only with the Ediacaran-Cambrian radiation of animals did diversity increase within most clades with fossilizable members. While taxonomic placement of many Proterozoic eukaryotes may be arguable, the presence of characters used for that placement is not. Focus on character evolution permits inferences about the innovations in cell biology and development that underpin the taxonomic and morphological diversification of eukaryotic organisms.     

Phylogeny of the genera Entamoeba and Endolimax as deduced from small-subunit ribosomal RNA sequences

We sequenced small-subunit ribosomal RNA genes (16S-like rDNAs) of 10 species belonging to the genera Entamoeba and Endolimax. This study was undertaken to (1) resolve the relationships among the major lineages of Entamoeba previously identified by riboprinting; (2) examine the validity of grouping the genera Entamoeba and Endolimax in the same family, the Entamoebidae; and (3) examine how different models of nucleotide evolution influence the position of Entamoeba in eukaryotic phylogenetic reconstructions. The results obtained with distance, parsimony, and maximum-likelihood analyses support monophyly of the genus Entamoeba and are largely in accord with riboprinting results. Species of Entamoeba producing cysts with the same number of nuclei from monophyletic groups. The most basal Entamoeba species are those that produce cysts with eight nuclei, while the group producing four-nucleated cysts is most derived. Most phylogenetic reconstructions support monophyly of the Entamoebidae. In maximum-likelihood and parsimony analyses, Endolimax is a sister taxon to Entamoeba, while in some distance analyses, it represents a separate lineage. The secondary loss of mitochondria and other organelles from these genera is confirmed by their relatively late divergence in eukaryotic 16S-like rDNA phylogenies. Finally, we show that the positions of some (fast-evolving) eukaryotic lineages are uncertain in trees constructed with models that make corrections for among-site rate variation.     

Ribosomal proteins in halobacteria

The amino acid sequences of 16 ribosomal proteins from archaebacterium Halobacterium marismortui have been determined by a direct protein chemical method. In addition, amino acid sequences of three proteins, S11, S18, and L25, have been established by DNA sequencing of their genes as well as by protein sequencing. Comparison of their sequences with those of ribosomal proteins from other organisms revealed that proteins S14, S16, S19, and L25 are related to both eukaryotic and eubacterial ribosomal proteins, being more homologous to eukaryotic than eubacterial counterparts, and proteins S12, S15, and L16 are related to only eukaryotic ribosomal proteins. Furthermore, some proteins are found to be similar to only eubacterial proteins, whereas other proteins show no homology to any other known ribosomal proteins. Comparisons of amino acid compositions between halophilic and nonhalophilic ribosomal proteins revealed that halophilic proteins gain aspartic and glutamic acid residues and significantly lose lysine and arginine residues. In addition, halophilic proteins seem to lose isoleucine as compared with Escherichia coli ribosomal proteins.     

PHYLOGENY, REPRODUCTIVE ISOLATION AND KIN RECOGNITION IN THE SOCIAL AMOEBA DICTYOSTELIUM PURPUREUM

Little is known about the population structure of social microorganisms, yet such studies are particularly interesting for the ways that genetic variation impacts their social evolution. Dictyostelium , a eukaryotic microbe widely used as a developmental model, has a social fruiting stage in which some formerly independent individuals die to help others. To assess genetic variation within the social amoeba Dictyostelium purpureum , we sequenced ∼4000 base pairs of ribosomal DNA (rDNA) from 37 isolates collected in Texas, Virginia, and Japan. Our analysis showed extensive genetic variation between populations and clear evidence of phylogenetic structure. We identified three major phylogenetic groups that were more different than other accepted species pairs. Tests using pairs of clones showed that both sexual macrocyst and asexual fruiting body formation were influenced by genetic divergence. Macrocysts were less likely to form between pairs of clones from different groups than from the same group. There was also a correlation between the genetic divergence of a pair of clones and their degree of mixing within fruiting bodies. These observations suggest that cryptic species might occur within D. purpureum and, more importantly, reveal how genetic variation impacts social interactions.     

Analysis of the in vivo assembly pathway of eukaryotic 40S ribosomal proteins

In eukaryotes, in vivo formation of the two ribosomal subunits from four ribosomal RNAs (rRNAs) and approximately 80 ribosomal proteins (r-proteins) involves more than 150 nonribosomal proteins and around 100 small noncoding RNAs. It is temporally and spatially organized within different cellular compartments: the nucleolus, the nucleoplasm, and the cytoplasm. Here, we present a way to analyze how eukaryotic r-proteins of the small ribosomal subunit (SSU) assemble in vivo with rRNA. Our results show that key aspects of the assembly of eukaryotic r-proteins into distinct structural parts of the SSU are similar to the in vitro assembly pathway of their prokaryotic counterparts. We observe that the establishment of a stable assembly intermediate of the eukaryotic SSU body, but not of the SSU head, is closely linked to early rRNA processing events. The formation of assembly intermediates of the head controls efficient nuclear export of the SSU and cytoplasmic pre-rRNA maturation steps.     

Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.     

Complete large subunit ribosomal RNA sequences from the heterokont algae ochromonas danica, nannochloropsis salina, and tribonema aequale, and phylogenetic analysis

The large subunit ribosomal RNA sequences from the heterokont algae Ochromonas danica, Nannochloropsis salina, and Tribonema aequale were determined. These sequences were combined with small subunit ribosomal RNA sequences in order to carry out a phylogenetic analysis based on neighbor-joining, maximum parsimony, and maximum likelihood methods. Our results indicate that heterokont fungi and heterokont algae each are monophyletic, and confirm that they together form a monophyletic group called ``stramenopiles.' Within the heterokont algae, the eustigmatophyte Nannochloropsis salina either clusters with the chrysophyte Ochromonas danica or forms a sister group to a cluster comprising the phaeophyte Scytosiphon lomentaria and the xanthophyte Tribonema aequale. The alveolates were identified as the closest relatives of the stramenopiles, but the exact order of divergence between the eukaryotic crown taxa could not be established with confidence. Received: 22 November 1996 / Accepted: 14 February 1997     

Intron dynamics in ribosomal protein genes

The role of spliceosomal introns in eukaryotic genomes remains obscure. A large scale analysis of intron presence/absence patterns in many gene families and species is a necessary step to clarify the role of these introns. In this analysis, we used a maximum likelihood method to reconstruct the evolution of 2,961 introns in a dataset of 76 ribosomal protein genes from 22 eukaryotes and validated the results by a maximum parsimony method. Our results show that the trends of intron gain and loss differed across species in a given kingdom but appeared to be consistent within subphyla. Most subphyla in the dataset diverged around 1 billion years ago, when the "Big Bang" radiation occurred. We speculate that spliceosomal introns may play a role in the explosion of many eukaryotes at the Big Bang radiation.