Drosophila mitochondrial DNA: a novel gene order

Part of the replication origin-containing A+T-rich region of the Drosophila yakuba mtDNA molecule and segments on either side of this region have been sequenced, and the genes within them identified. The data confirm that the small and large rRNA genes lie in tandem adjacent to that side of the A+T-rich region which is replicated first, and establish that a tRNAval gene lies between the two rRNA genes and that URF1 follows the large rRNA gene. The data further establish that the genes for tRNAile, tRNAgln, tRNAf-met and URF2 lie in the order given, on the opposite side of the A+T-rich region to the rRNA genes and, except for tRNAgln, are contained in the opposite strand to the rRNA, tRNAval and URF1 genes. This is in contrast to mammalian mtDNAs where all of these genes are located on the side of the replication origin which is replicated last, within the order tRNAphe, small (12S) rRNA, tRNAval, large (16S) rRNA, tRNAleu, URF1, tRNAile, tRNAgln, tRNAf-met and URF2, and, except tRNAgln, are all contained in the same (H) strand. In D. yakuba URF1 and URF2, the triplet AGA appears to specify an amino acid, which is again different from the situation found in mammalian mtDNAs, where AGA is used only as a rare termination codon.     

A cluster of six tRNA genes in Drosophila mitochondrial DNA that includes a gene for an unusual tRNAserAGY.

Genes for URF3, tRNAala, tRNAarg, tRNAasn, tRNAserAGY, tRNAglu, tRNAphe, and the carboxyl terminal segment of the URF5 gene have been identified within a sequenced segment of the mtDNA molecule of Drosophila yakuba. The genes occur in the order given. The URF5 and tRNAphe genes are transcribed in the same direction as replication while the URF3 and remaining five tRNA genes are transcribed in the opposite direction. Considerable differences exist in the relative arrangement of these genes in D. yakuba and mammalian mtDNA molecules. In the tRNAserAGY gene an eleven nucleotide loop, within which secondary structure formation seems unlikely, replaces the dihydrouridine arm, and both the variable loop (six nucleotides) and the T phi C loop (nine nucleotides) are larger than in any other D. yakuba tRNA gene. As available evidence is consistent with AGA codons specifying serine rather than arginine in the Drosophila mitochondrial genetic code, the possibility is considered that the 5'GCU anticodon of the D. yakuba tRNAserAGY gene can recognize AGA as well as AGY codons.     

The ribosomal RNA genes of Drosophila mitochondrial DNA.

The nucleotide sequence of a segment of the mtDNA molecule of Drosophila yakuba which contains the A+T-rich region and the small and large rRNA genes separated by the tRNAval gene has been determined. The 5' end of the small rRNA gene was located by S1 protection analysis. In contrast to mammalian mtDNA, a tRNA gene was not found at the 5' end of the D. yakuba small rRNA gene. The small and large rRNA genes are 20.7% and 16.7% G+C and contain only 789 and 1326 nucleotides. The 5' regions of the small rRNA gene (371 nucleotides) and of the large rRNA gene (643 nucleotides) are extremely low in G+C (14.6% and 9.5%, respectively) and convincing sequence homologies between these regions and the corresponding regions of mouse mt-rRNA genes were found only for a few short segments. Nevertheless, the entire lengths of both of the D. yakuba mt-rRNA genes can be folded into secondary structures which are remarkably similar to secondary structures proposed for the rRNAs of mouse mtDNA. The replication origin-containing, A+T-rich region (1077 nucleotides; 92.8% A+T), which lies between the tRNAile gene and the small rRNA gene, lacks open reading frames greater than 123 nucleotides.     

Nucleotide sequence of a segment of Drosophila mitochondrial DNA that contains the genes for cytochrome c oxidase subunits II and III and ATPase subunit 6.

The nucleotide sequence of a segment of the mtDNA molecule of Drosophila yakuba has been determined, within which have been identified the genes for tRNAleuUUR, cytochrome c oxidase subunit II (COII), tRNAlys, tRNAasp, URFA6L, ATPase subunit 6 (ATPase6), cytochrome c oxidase subunit III (COIII) and tRNAgly. The genes are arranged in the order given and all are transcribed from the same strand of the molecule in a direction opposite to that in which replication proceeds around the molecule. The tRNAlys gene is unusual among mitochondrial tRNAlys genes in that it contains a CTT anticodon. The triplet AGA is used to specify an amino acid in all of the COII, COIII, ATPase6, and URFA6L genes. However, the AGA codons found in these four polypeptide genes correspond in position to codons which specify nine different amino acids, but never arginine, in the equivalent polypeptide gene which have been sequenced from mtDNAs of mouse, yeast and Zea mays.     

Drosophila Melanogaster Mitochondrial DNA: Gene Organization and Evolutionary Considerations

The sequence of a 8351-nucleotide mitochondrial DNA (mtDNA) fragment has been obtained extending the knowledge of the Drosophila melanogaster mitochondrial genome to 90% of its coding region. The sequence encodes seven polypeptides, 12 tRNAs and the 3' end of the 16S rRNA and CO III genes. The gene organization is strictly conserved with respect to the Drosophila yakuba mitochondrial genome, and different from that found in mammals and Xenopus. The high A + T content of D. melanogaster mitochondrial DNA is reflected in a reiterative codon usage, with more than 90% of the codons ending in T or A, G + C rich codons being practically absent. The average level of homology between the D. melanogaster and D. yakuba sequences is very high (roughly 94%), although insertion and deletions have been detected in protein, tRNA and large ribosomal genes. The analysis of nucleotide changes reveals a similar frequency for transitions and transversions, and reflects a strong bias against G + C on both strands. The predominant type of transition is strand specific.     

Assembly of the mitochondrial membrane system. Sequences of yeast mitochondrial tRNA genes

Two cytoplasmic "petite" (rho-) clones of Saccharomyces cerevisiae have been selected for the retention of the aspartic acid tRNA gene. The two clones, designated DS200/A102 and DS200/A5, have tandemly repeated segments of mitochondrial DNA (mtDNA) with unit lengths of 1,000 and 6,400 base pairs, respectively. The DS200/A102 genome has a single tRNA gene with a 3'-CUG-5' anticodon capable of recognizing the 5'-GAC-3' and 5'-GAU-3' codons for aspartic acid. The mtDNA segment of DS200/A102 has been determined to represent the wild type sequence from 5.3 to 6.8 map units. The genome of DS200/A5 is more complex encompassing the region of wild type mtDNA from 3.5 to 12.7 units. A continuous sequence has been obtained from 3.5 to 8.6 units. In addition to the aspartic acid tRNA, this region codes for the tRNAUGCAla,tRNAUCUArg, tRNAACGArg, tRNAGCUSer,tRNAUCCGly and tRNAUUULys. The DNA sequence of the DS200/A5 genome has allowed us to deduce the secondary structures of the seven tRNAs and to assign precise map positions for their genes. All the tRNAs except tRNA GUCAsp exhibit most of the invariant features of prokaryotic and eukaryotic tRNAs. The aspartic acid tRNA has unusual D and T psi C loops. The structure of this tRNA is similar to the mitochondrial initiator tRNA of Neurospora crassa (Heckman, J.E., Hecker, L.I., Shwartzbach, S.D., Barnett, W.E., Baumstark, B., and RajBhandary, U.L. Cell 13, 83-95).     

Two drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F.

One Drosophila melanogaster tRNAGly gene occurs on each 1.1-2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.     

Analysis of nucleotide substitutions of mitochondrial DNAs in Drosophila melanogaster and its sibling species

To study the rate and pattern of nucleotide substitution in mitochondrial DNA (mtDNA), we cloned and sequenced a 975-bp segment of mtDNA from Drosophila melanogaster, D. simulans, and D. mauritiana containing the genes for three transfer RNAs and parts of two protein- coding genes, ND2 and COI. Statistical analysis of synonymous substitutions revealed a predominance of transitions over transversions among the three species, a finding differing from previous results obtained from a comparison of D. melanogaster and D. yakuba. The number of transitions observed was nearly the same for each species comparison, including D. yakuba, despite the differences in divergence times. However, transversions seemed to increase steadily with increasing divergence time. By contrast, nonsynonymous substitutions in the ND2 gene showed a predominance of transversions over transitions. Most transversions were between A and T and seemed to be due to some kind of mutational bias to which the A + T-rich mtDNA of Drosophila species may be subject. The overall rate of nucleotide substitution in Drosophila mtDNA appears to be slightly faster (approximately 1.4 times) than that of the Adh gene. This contrasts with the result obtained for mammals, in which the mtDNA evolves approximately 10 times faster than single-copy nuclear DNA. We have also shown that the start codon of the COI gene is GTGA in D. simulans and GTAA in D. mauritiana. These codons are different from that of D. melanogaster (ATAA).      

Cloning of the mitochondrial genome of Rana catesbeiana and the nucleotide sequences of the ND2 and five tRNA genes

The entire mitochondrial genome of Rana catesbeiana was cloned into a plasmid vector pBR322 at the unique BamHI site and the nucleotide sequences of the ND2 gene and of its flanking genes were determined. The ND2 gene was encoded by 1,033 base pairs and, as deduced from the nucleotide sequence, the ND2 product consisted of 344 amino acids with a molecular weight of 37,561. This gene was flanked on the 5' side by the tRNA genes for isoleucine, glutamine, and methionine and on the 3' side by those for tryptophan and alanine. These genes were the same in their organization as those found in the mammalian and Xenopus laevis mitochondrial genomes. A comparison of the putative amino acid sequences of the ND2 proteins of different animal species revealed that six regions in the sequence were well conserved during evolution, suggesting that some of these conserved sequences are crucial for biological activity of the ND2 protein. The nucleotide sequence homologies between the five tRNA genes of R. catesbeiana and their counterparts of mammals and X. laevis were in the range of 55 to 85%, depending on the tRNA and animal species.     

Glutamate tRNA genes are adjacent to 5S RNA genes in Drosophila and reveal a conserved upstream sequence (the ACT-TA box).

In Drosophila melanogaster at least six transfer RNA genes are located adjacent to the 3' end of the 5S RNA gene cluster. Three of these have been sequenced and identified as coding for glutamate tRNA4. In the chromosome they are arranged as tandem repeats on the same DNA strand and transcribed in the same direction as is 5S DNA, towards the centromere. We have also identified a sequence, the ACT-TA box, that is highly conserved among the polymerase III transcribed genes. Usually the sequence is located at 37 +/- 8 base pairs upstream from the first nucleotide of the structural gene. A similar sequence is also observed upstream of yeast and silkworm tRNA genes and the mitochondrial tRNA genes of mouse and humans.     

Cloning of the mitochondrial genome of Anopheles quadrimaculatus

The entire 15 kilobase (kb) Anopheles quadrimaculatus mitochondrial DNA (mtDNA) was cloned as three EcoRI fragments in a bacteriophage vector and then subcloned into plasmid vectors. The cloned DNA was physically mapped with restriction endonucleases, and the maps were compared to the restriction patterns of native A. quadrimaculatus mtDNA. Several genes were mapped by sequencing the ends of A. quadrimaculatus mtDNA subclones and by hybridization with the previously characterized Aedes albopictus mtDNA clones. These portions of the genetic map were identical in gene order to those of Drosophila yakuba. The predicted amino acid sequence of the protein coding regions that were sequenced were between 72% and 98% homologous to D. yakuba. The cloned mtDNA will be useful as a probe for population genetic analysis of mosquitoes.     

Identification of two methionine transfer RNA genes in the maize mitochondrial genome

Two methionine transfer RNA (tRNA) genes were identified in the maize mitochondrial genome by nucleotide sequence analysis. One tRNA gene was similar in nucleotide sequence and secondary structure to the initiator methionine tRNA genes of eubacteria and higher plant chloroplast genomes. This tRNA gene also had extensive nucleotide homology (99%) with an initiator methionine tRNA gene described for the wheat mitochondrial genome. The other methionine tRNA gene sequence was distinct and more closely resembled an elongator methionine tRNA.     

Mitochondrial sequence evolution in spiders: intraspecific variation in tRNAs lacking the TPsiC Arm

Analyses of mitochondrial DNA sequences from three species of Habronattus jumping spiders (Chelicerata: Arachnida: Araneae) reveal unusual inferred tRNA secondary structures and gene arrangements, providing new information on tRNA evolution within chelicerate arthropods. Sequences from the protein-coding genes NADH dehydrogenase subunit 1 (ND1), cytochrome oxidase subunit I (COI), and subunit II (COII) were obtained, along with tRNA, tRNA, and large-subunit ribosomal RNA (16S) sequences; these revealed several peculiar features. First, inferred secondary structures of tRNA and, likely, tRNA, lack the TPsiC arm and the variable arm and therefore do not form standard cloverleaf structures. In place of these arms is a 5-6-nt T arm-variable loop (TV) replacement loop such as that originally described from nematode mitochondrial tRNAs. Intraspecific variation occurs in the acceptor stem sequences in both tRNAs. Second, while the proposed secondary structure of the 3' end of 16S is similar to that reported for insects, the sequence at the 5' end is extremely divergent, and the entire gene is truncated about 300 nt with respect to Drosophila yakuba. Third, initiation codons appear to consist of ATY (ATT and ATC) and TTG for ND1 and COII, respectively. Finally, Habronattus shares the same ND1-tRNA-16S gene arrangement as insects and crustaceans, thus illustrating variation in a tRNA gene arrangement previously proposed as a character distinguishing chelicerates from insects and crustaceans.