Analysis of genetic variation in unisexual and bisexual lizard species of the genus Leiolepis from Southeast Asia

Using multilocus DNA fingerprinting with microsatellite probes (CAC)5, (GACA)4, (GGCA)4 and (GATA)4, intraspecific variation of the Southeast Asian lizards belonging to the genus Leiolepis (bisexual species Leiolepis reevesii and triploid parthenogenetic species Leiolepis guentherpetersi) was first examined. The L. guentherpetersi lizards were characterized by monophyletic DNA fingerprint profiles for the loci detected by the (GACA)4, (GGCA)4, and (CAC)5 probes, in terms of intrapopulation similarity index constituting S = 0.96. This was different from the individual-specific profiles of the lizards from bisexual, presumably parental species, L. reevesii (S = 0.6; P < 0.001). Genetic homogeneity of triploid L. guentherpetersi lizards at the loci examined serves as one of the arguments for the parthenogenetic nature of this species. Genetic variability of triploid parthenogenetic species L. guentherpetersi appeared to be comparable with that reported earlier for the Caucasian rock lizards of the genus Darevskia, namely, D. dahlia, D. armeniaca, and D. unisexualis (P > 0.05). The results of DNA fingerprinting analysis of the same L. guentherpetersi samples with the (GATA)4 hybridization probe were unexpected. Variability of parthenogenetic species L. guentherpetersi at the (GATA)n markers was remarkably higher than that at other DNA markers (S = 0.35; P = 3.08 x 10(-11)), being comparable to the variation of the (GATA)n DNA markers in bisexual species L. reevesii (P = 0.74). The reasons for high polymorphism of the (GATA)n-containing loci in L. guentherpetersi still remain unclear. This polymorhism is probably associated with high instability of the loci, which can be revealed by means of family analysis of parthenogenetic offspring.     

Polymorphic analysis of mitochondrial 16S rRNA gene of two lizard species in Vietnam

Analysis of mitochondrial 16S rRNA sequences of four speciments from two lizard species (Leiolepis guentherpetersi and L. reevesii) showed identity of 91.1–91.6% and the genetic distances were 8.8–9.3%. The two speciments (C5 and C7) of L. reevesii species have the homology of 96.5–99.4% with L. belliana and L. reevesii, respectively. Whereas, those of L. guentherpetersi species (S4 and S6) have higher homology of 99.6–100% with L. guttata and L. guentherpetersi, respectively. These mitochondrial 16S rRNA sequences of individuals from L. guentherpetersi (S4 and S6) and L. reevesii (C5 and C7) were deposited in GenBank with accession number EU428186, EU428187, EU428188, and EU428189, respectively.     

Detection of genetically unstable loci in parthenogenic families of lizards of theLacerta genus by DNA fingerprinting

Two parthenogenic families of unisexual species of Caucasian rock lizards of genusLacerta, L. armeniaca andL. unisexualis, were analyzed by DNA fingerprinting. Inheritance of M13 minisatellite and of (GACA) _n , (GATA) _n , and (TCC) _n microsatellite loci in the first generation of the lizards was studied. M13, (GACA) _n , and (TCC) _n loci in the families ofL. armeniaca were strictly inherited, as well as M13 and (GACA) _n loci in the families ofL. unisexualis: each DNA fragment in the fingerprint patterns of progeny could be detected in the maternal pattern. However, when a (TCC)₅₀ microsatellite probe was applied in the study ofL. unisexualis families, specific DNA fragments with altered mobility were revealed in the progeny patterns, and the frequency of such events was rather high. It might be hypothesized that some of the (TCC) _n loci inL. unisexualis genome are highly mutable. Hence, the family analysis allowed us to demonstrate experimentally the presence of genetically unstable loci in genomes of parthenogenic species of vertebrates. The nature and mechanism of the instability of these loci in parthenogenesis remain obscure.     

Study of Allelic Polymorphism of (GATA) n -Containing Loci in Parthenogenetic Lizards Darevskia unisexualis (Lacertidae)

The genesis of mini- and microsatellite loci, which is under extensive study in humans and some other bisexual species, has been virtually overlooked in species with clonal mode of reproduction. Earlier, using multilocus DNA fingerprinting, we have examined variability of some mini- and microsatellite DNA markers in parthenogenetic lizards from the genus Darevskia. In particular, mutant (GATA)n-restriction DNA fragments were found in Darevskia unisexualis. In the present study, we examined intraspecific polymorphism of three cloned loci of D. unisexualis—Du323, Du215, and Du281—containing (GATA)₇GAT(GATA)₂, GAT(GATA)₉, and (GATA)₁₀TA(GATA) microsatellite clusters, respectively. Different levels of intrapopulation and interpopulation variability of these loci were found. Locus Du281 showed the highest polymorphism—(six allelic variants in the sample of 68 DNA specimens). Three alleles were found for locus Du215. The Du323 locus was electrophoretically invariant. The primers chosen for loci Du323, Du215, and Du281 were also used for PCR analysis of homologous loci in two presumptive parental bisexual species, D. valentini and D. nairensis. The PCR products of the corresponding loci of the parental species had approximately the same size (200 bp) as their counterparts in D. unisexualis, but the polymorphism levels of the paternal, maternal, and hybrid species were shown to be somewhat different. These data on the structure of the D. unisexualis loci provide a possibility to study genetic diversity in the parthenogenetic species D. unisexualis and other related unisexual and bisexual species of this genus, which can provide new information on the origin of parthenogenetic species and on the phylogenetic relationships in the genus Darevskia. These data can also be used for resolving problems of marking the lizard genome, which is still poorly studied.     

Genetic variation in parthenogenetic Caucasian rock lizards of the genus Lacerta (L. dahli, L. armeniaca, L. unisexualis) analyzed by DNA fingerprinting

Multilocus DNA fingerprinting has been used to study the variability of some mini- and microsatellite sequences in parthenogenetic species of Caucasian rock lizards of the genus Lacerta (L. dahli, L. armeniaca and L. unisexualis). We demonstrate that these clonally reproducing lizards possess species-specific DNA fingerprints with a low degree of intra- and interpopulation variation. Mean indices of similarity obtained using M13 DNA, (GACA)4 and (TCC)50 as probes were 0.962 and 0.966 in L. dahli and L. armeniaca, respectively. The mean index of similarity obtained using M 13 and GATA probes in L. unisexualis was estimated to be 0.95. However, despite the high degree of band-sharing, variable DNA fragments were revealed in all populations with the microsatellite probes. An particularly high level of variability was observed for (TCC)n microsatellites in populations of L. unisexualis. In fact TCC-derived DNA fingerprints were close to being individual-specific, with a mean index of similarity of 0.824. Fingerprint analysis of parthenogenetic families of L. armeniaca showed that all maternal fragments were inherited together by the progeny, and no differences in fingerprint patterns were observed. On the other hand, while identical DNA fingerprints were obtained from L. unisexualis families with M13 and (GATA)4 probes, use of the (TCC)50 probe revealed remarkable intrafamily variation in this species. It is assumed that the genetic heterogeneity observed in parthenogenetic populations may be explained, at least in part, by the existence of genetically unstable microsatellite loci. Our data serve to illustrate processes of spontaneous mutagenesis and the initial stages of clonal differentiation in natural populations of the lizard species studied.     

Intra- and interspecific polymorphism of (AAT) n in microsatellite locus Du47D in parthenogenetic species of the genus Darevskia

The molecular structure of the allelic variants of (AAT) _n of the Du47D microsatellite locus was determined in parthenogenetic lizards Darevskia dahli, D. armeniaca, and D. rostombekovi. Comparative analysis of these alleles showed that they were characterized by perfect structure of microsatellite cluster, and were different in the number of (AAT) monomeric units, as well as in the combinations of species-specific substitutions and deletions in the microsatellite flanking regions. Molecular structure of microsatellite cluster, species-specific single nucleotide polymorphism (SNP), and different representation of alleles Du47 in the samples of parthenogenetic species examined point to the origin of the alleles from different bisexual species, which is consistent with the hybrid nature of unisexual species of the genus Darevskia. In addition, these data reflect different combination patterns of interspecific hybridization events with the participation of the same bisexual species upon the formation of hybrid genomes of parthenogenetic species. Possible application of the allelic variants of microsatellite loci of parthenogenetic lizards as the genetic markers for the analysis of the genomes of parthenogenetic species in the light of evolution, ecology, and parthenogenetic type of reproduction in vertebrates is discussed.     

Genomic variation in parthenogenetic lizard Darevskia armeniaca: evidence from DNA fingerprinting data

Microsatellites, or short tandem repeats, are abundant across genomes of most organisms. It is evident that the most straightforward and conclusive way of studying mutations in microsatellite-containing loci is to use clonally transmitted genomes or DNA sequences inherited in multigeneration pedigrees. At present, little is known about the origin of genetic variation in species that lack effective genetic recombination. DNA fingerprinting in 43 families of the parthenogenetic lizard species Darevskia armeniaca (131 siblings), using (GACA)(4), (GGCA)(4), (GATA)(4), and (CAC)(5) probes, revealed mutant fingerprints in siblings that differed from their mothers in several restriction DNA fragments. In some cases, the mutant fingerprints detected in siblings were also found in population samples. The mutation rate for new restriction fragment length estimated by using multilocus probes varied from 0.8 x 10(-2) to 4.9 x 10(-2) per band/per sibling. Probably, the most variations detected as restriction fragment length polymorphism have germ-line origin, but somatic changes of (CAC)(n) fingerprints in adult lizards were also observed. These results provide new evidence of existing unstable regions in genomes of parthenogenetic vertebrate animals, which provide genetic variation in unisexual populations.     

Instability of (GATA)<Subscript> n</Subscript> microsatellite loci in the parthenogenetic Caucasian rock lizard<Emphasis Type="Italic"> Darevskia unisexualis</Emphasis> (Lacertidae)

Mini- and microsatellites, comprising tandemly repeated short nucleotide sequences, are abundant dispersed repetitive elements that are ubiquitous in eukaryotic genomes. In humans and other bisexual species hypervariable mini- and microsatellite loci provide highly informative systems for monitoring of germline and somatic instability. However, little is known about the mechanisms by which these loci mutate in species that lack effective genetic recombination. Here, multilocus DNA fingerprinting was used to study M13 minisatellite and (GATA) _n microsatellite instability in the parthenogenetic Caucasian rock lizard Darevskia unisexualis (Lacertidae). DNA fingerprinting of 25 parthenogenetic families, from six isolated populations in Armenia (comprising a total of 84 siblings), using the oligonucleotide (GATA)₄ as a hybridization probe, revealed mutant fingerprinting phenotypes in 13 siblings that differed from their mothers in several restriction DNA fragments. In three families (8 siblings), the mutations were present in the germline. Moreover, the mutant fingerprint phenotypes detected in siblings were also present in population DNA samples. No intrafamily variations in DNA fingerprint patterns were observed with the M13 minisatellite probe. Estimates of the mutation rate for (GATA) _n microsatellite loci in D. unisexualis showed that it was as high as that seen in some bisexual species, reaching 15% per sibling or 0.95% per microsatellite band. Furthermore, in one case, a somatic (GATA) _n microsatellite mutation was observed in an adult lizard. These findings directly demonstrate that mutations in (GATA) _n microsatellite loci comprise an important source of genetic variation in parthenogenetic populations of D. unisexualis.Communicated by G. P. Georgiev     

Multiple origins of parthenogenesis,and a revised species phylogeny for the Southeast Asian butterfly lizards,Leiolepis

Hybridization often occurs in areas of secondary contact between closely related species. In some cases these hybridization events can create hybrid offspring that are reproductively viable as new parthenogenetic species. The genus Leiolepis contains nine species that collectively range throughout continental Southeast Asia. Of these, four are unisexual (some diploid and some triploid). We analyzed a multi‐locus dataset within a multi‐lineage coalescent framework to infer the origins of these parthenogenetic hybrid species. Our results provide evidence that repeated hybridization events between L. reevesii and L. guttata have led to the formation of all four distinct parthenogenetic species. Our data further suggest there have been low levels of mitochondrial introgression between L. belliana and L. reevesii at their contact zone in southern Cambodia. This work addresses contentious species boundaries and provides the first taxon‐complete hypothesis of relationships for the butterfly lizards. © 2014 The Linnean Society of London, Biological Journal of the Linnean Society, 2014, 113 , 1080–1093.     

Study of allelic polymorphism of (GATA)n-containing loci in parthenogenetic lizards Darevskia unisexualis (Lacertidae)

The genesis of mini- and microsatellite loci, which is under extensive study in humans and some other bisexual species, have been virtually overlooked in species with clonal mode of reproduction. Earlier, using multilocus DNA fingerprinting, we have examined variability of some mini- and microsatellite DNA markers in parthenogenetic lizards from the genus Darevskia. In particular, mutant (GATA)n-restrictive DNA fragments were found in Darevskia unisexualis. In the present study, we examined intraspecific polymorphism of three cloned loci of D. unisexualis--Du323, Du215, and Du281--containing (GATA)7GAT(GATA)2, GAT(GATA)9, and (GATA)10TA(GATA) microsatellite clusters, respectively. Different levels of intrapopulation and interpopulation variability of these loci were found. Locus Du281 showed the highest polymorphism--six allelic variants (in the sample of 68 DNA specimens). Three alleles were found for locus Du215. The Du325 locus was electrophoretically invariant. The primers chosen for loci Du323, Du215, and Du281 were also used for PCR analysis of homologous loci in two presumptive parental bisexual species, D. valentini and D. nairensis. The PCR products of the corresponding loci of the parental species had approximately the same size (approximately 200 bp) as their counterparts in D. unisexualis, but the polymorphism levels of the paternal, maternal, and hybrid species were shown to be somewhat different. These data on the structure of the D. unisexualis loci provide a possibility to study genetic diversity in the parthenogenetic species D. unisexualis and other related unisexual and bisexual species of this genus, which can provide new information on the origin of parthenogenetic species and on the phylogenetic relationships in the genus Darevskia. These data can also be used for resolving problems of marking the lizard genome, which is still poorly studied.     

The Organization of Genetic Diversity in the Parthenogenetic Lizard CNEMIDOPHORUS TESSELATUS

The parthenogenetic lizard species Cnemidophorus tesselatus is composed of diploid populations formed by hybridization of the bisexual species C. tigris and C. septemvittatus, and of triploid populations derived from a cross between diploid tesselatus and a third bisexual species, C. sexlineatus. An analysis of allozymic variation in proteins encoded by 21 loci revealed that, primarily because of hybrid origin, individual heterozygosity in tesselatus is much higher (0.560 in diploids and 0.714 in triploids) than in the parental bisexual species (mean, 0.059). All triploid individuals apparently represent a single clone, but 12 diploid clones were identified on the basis of genotypic diversity occurring at six loci. From one to four clones were recorded in each population sampled. Three possible sources of clonal diversity in the diploid parthenogens were identified: mutation at three loci has produced three clones, each confined to a single locality; genotypic diversity at two loci apparently caused by multiple hybridization of the bisexual species accounts for four clones; and the remaining five clones apparently have arisen through recombination at three loci. The relatively limited clonal diversity of tesselatus suggests a recent origin. The evolutionary potential of tesselatus and of parthenogenetic forms in general may be less severely limited than has generally been supposed.     

Molecular characterization of allelic variants of (GATA)n microsatellite loci in parthenogenetic lizards Darevskia unisexualis (Lacertidae)

Populations of parthenogenetic lizards of the genus Darevskia consist of genetically identical animals, and represent a unique model for studying the molecular mechanisms underlying the variability and evolution of hypervariable DNA repeats. As unisexual lineages, parthenogenetic lizards are characterized by some level of genetic diversity at microsatellite loci. We cloned and sequenced a number of (GATA)n microsatellite loci of Darevskia unisexualis. PCR products from these loci were also sequenced and the degree of intraspecific polymorphism was assessed. Among the five (GATA)n loci analysed, two (Du215 and Du281) were polymorphic. Cross-species analysis of Du215 and Du281 indicate that the priming sites at the D. unisexualis loci are conserved in the bisexual parental species, D. raddei and D. valentini. Sequencing the PCR products amplified from Du215 and Du281 and from monomorphic Du323 showed that allelic differences at the polymorphic loci are caused by microsatellite mutations and by point mutations in the flanking regions. The haplotypes identified among the allelic variants of Du281 and among its orthologues in the parental species provide new evidence of the cross-species origin of D. unisexualis. To our knowledge, these data are the first to characterize the nucleotide sequences of allelic variants at microsatellite loci within parthenogenetic vertebrate animals.     

Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: Implications in clad identification

The enzymatic amplification of genomic DNA with an arbitrary primer generates informative band profile useful for genome analysis. We used a set of synthetic oligodeoxyribonucleotide primers OAT15.2 (GACA)_3.75, OAT18. 2 (GACA)_4.5, OAT24.2 (GACA)₆, OAT36 (GACA)₉, comprising 4–9 consecutive units of GACA repeat, O33.15 (CACCTCTCCACCTGCC) and 033.6 (CCTCCAGCCCTCCTCCAGCCCT) for RAPD reactions of genomic DNA from different sources. The GACA based oligos of 15 and 18 base residues generated discernible genome specific amplicons whereas primers larger than 18 bases revealed smeary signals. The other oligos O33.15 and O33.6 also generated genome specific amplicons with more bands compared with those obtained from OAT15.2 or OAT18.2. The presence of OAT15.1 (GATA)_3.75 and OAT15.2 (GACA)_3.75 sequences in different genomes were ascertained by independent dot-blot hybridization prior to using them for RAPD reactions. The RAPD amplicons generated by evolutionarily conserved primer(s) or sequences shared by many species may be useful for clad identification in controversial systematics, comparative genome analysis, and for establishing the phylogenetic status of an organism.     

Quantitative evaluation of gene variation and interpopulation differentiation of parthenogenetic species of Darevskia lizards based on mini- and microsatellite DNA markers

Methods of estimating within- and between-population gene diversity in parthenogenetic species using mini- and microsatellite DNA markers and modified Wright's FST statistic are presented with special reference to model populations of lizards of the genus Darevskia (D. dahli, D. armeniaca, D. unisexualis). We used DNA fingerprinting data for several populations of these species examined earlier. The effects of variation in M13, minisatellite, (GACA)n and (TCC)n microsatellite loci on the formation of within-population gene diversity in parthenogenetic species D. dahli and D. armeniaca were shown to be different. The equality of the realized gene diversity H and its maximum possible value Hmax in two populations of D. dahli (Hmax = 0.032, H = 0.031, P < < 0.0431; Hmax = 0.024, H = 0.027, P = 0.09) and D. armeniaca (Hmax = 0.05, H = 0.053, P = 0.03; Hmax = 0.054, H = 0.055, P = 0.02) suggests that variation in (GACA)n loci substantially contributes to the maintenance of within-population genetic diversity. Analysis of between-population genetic diversity using loci M13, (GACA)n, and (TCC)n showed differentiation of D. dahli populations from northeastern and northwestern Armenia (FST = 0.0272, P = 3 x 10(-13)) and genetic homogeneity of the Armenian and Introduced to the Ukraine populations of D. armeniaca characteristic of one clone (FST = 0, P = 1).     

The organization of the evolutionarily conserved GATA/GACA repeats in the mouse genome

Simple repeated GATA and GACA sequences which were originally isolated from sex-specific snake satellite DNA have been found subsequently in all eukaryotes studied. The organization of these sequences within the mouse genome was investigated here by using synthetic oligonucleotide probes as a novel tool in comparison with conventional hybridization probes. Southern blot hybridization showed sex-specific patterns with both the (GATA)₄ and (GACA)₄ oligonucleotide probes, as previously described with conventional probes. The quantitative analysis of two mouse DNA phage libraries and of 25 isolated GATA-positive phage clones revealed intensive interspersion of GATA sequences with GACA, and with other repetitive and single-copy sequences. Ubiquitous interspersion and homogeneous genomic distribution of GATA and GACA sequences were confirmed by hybridization in situ of the oligonucleotide probes to metaphase chromosomes. The lengths of the GATA and GACA stretches were found to vary considerably in the individual phage clones. DNA inserts from 20 phages were assigned to autosomes and sex chromosomes and three genomic fragments were found to be confined to the Y chromosome. The organization of GATA and GACA sequences is discussed in the context of their evolutionary potential and possible conservation mechanisms.     

MITOCHONDRIAL-DNA ANALYSES AND THE ORIGIN AND RELATIVE AGE OF PARTHENOGENETIC LIZARDS (GENUS CNEMIDOPHORUS). IV. NINE SEXLINEATUS-GROUP UNISEXUALS

Mitochondrial DNAs (mtDNAs) from nine morphologically distinct unisexual species and five bisexual species of lizards, all from the sexlineatus species-group of Cnemidophorus, were compared using restriction endonucleases. The unisexual lizards have mtDNAs that are identical at all or nearly all of the 128 sites cleaved. Although differing little in sequence, some mtDNAs differed in size due to the presence of tandem sequence duplications. Phylogenetic analysis of cleavage maps indicates that the mtDNAs of the unisexuals are most similar to that of the bisexual species C. inornatus. Considerable mtDNA diversity exists among C. inornatus populations, and one geographically restricted subspecies, C. i. arizonae, was identified as the most probable maternal ancestor of all nine unisexuals. All but one of these are triploid, and all have at least one C. inornatus gene complement. This, together with the homogeneity of their mtDNAs, suggests that all stem from one or a small number of allodiploid females (presumably parthenogenetic) that originated in a restricted geographic area in the recent past. These data, when combined with those from allozyme studies, preclude the possibility that most of the triploid unisexuals could have arisen via fertilization of an unreduced diploid ovum from one species by a haploid sperm from a different species.     

Cytogenetics of ticks (Acari: Ixodoidea)

Haemaphysalis longicornis consists of diploid bisexual races (20+ XX; 20+X), triploid obligatory parthenogenetic races (30–35 chromosomes) and an aneuploid race capable of bisexual and parthenogenetic reproduction (22–28 chromosomes). Karyotypes were analyzed for each race. Hybridization failed between diploid and triploid races, but succeeded between bisexual diploid males and parthenogenetic aneuploid females. F₁ and F₂ progeny were produced and their chromosomes studied. Crossing of F₁ progeny to a bisexual race was successful. Parthenogenetic ability was almost completely lost in F₁ and F₂ females. Several possible modes of evolution from diploid bisexual individuals to triploid parthenogenetic ones are discussed as is species characterization in taxa with races reproducing bisexually, parthenogenetically and by a combination of both methods.Supported in part by National Science Foundation Research Grant GB-21008, National Institute of Allergy and Infectious Diseases (NIH) Grant 09556 and the United States Army Medical Research and Development Command, Office of The Surgeon General, Department of the Army, Washington, D. C. 20315, U.S.A.     

Anchored simple-sequence repeats as primers to generate species-specific DNA markers in Lolium and Festuca grasses

Simple-sequence repeats (SSRs) comprising three tetranucleotide repeat sequences with two-base ’anchors’, namely 5′-(AGAC)₄GC, 5′-AC(GACA)₄ and 5′-(GACA)₄GT, were used in PCR reactions as primers to develop inter-SSR DNA fingerprints of the outbreeding grass species Lolium multiflorum, L. perenne, Festuca pratensis and F. arundinacea. Each species was represented by DNA samples from 3 to 6 varieties. In all four species distinctive species-specific DNA profiles were produced that were common across a number of varieties despite their diverse origin. While the fingerprints of the two ryegrasses, L. multiflorum and L. perenne, were the most similar, a number of inter-SSR DNA markers were generated that enabled them to be distinguished from each other. Some slight variations were found between varieties, which provided putative variety-specific markers for cultivar identification. In addition, variations in the DNA profiles of the genotypes of L. multiflorum and F. pratensis were examined, and the results showed that variety-specific fingerprints are integrated patterns made up from the profiles of individual genotypes. Amongst the primers used, AC(GACA)₄ generated the best distinction between Lolium and Festuca individuals and provides an effective new tool for genome identification. A number of species-discriminating sequences, ranging in size between 550 bp and 1,600 bp, were cloned: three clones for F. pratensis, one clone for L. multiflorum and one clone for F. arundinacea. A F. pratensis fragment pFp 78H582 was sequenced. Southern hybridization confirmed the presence of this fragment in F. arundinacea (which contains one genome of F. pratensis), but no homology was found with L. multiflorum. However, a F. arundinacea clone amplified with (GACA)₄GT, pFa 104H1350, was found to be unique to the F. arundinacea genome. Received: 23 June 1999 / Accepted: 27 August 1999     

Quantitative Assessment of Gene Diversity and Between-Population Differentiation of Parthenogenetic Lizard of the Genus DarevskiaUsing Mini- and Microsatellite DNA Markers

Methods of estimating within- and between-population gene diversity in parthenogenetic species using mini- and microsatellite DNA markers and modified Wright's F _ST statistic are presented with special reference to model populations of lizards of the genus Darevskia(D. dahli, D. armeniaca, D. unisexualis). We used DNA fingerprinting data for several populations of these species examined earlier. The effects of variation in M13 minisatellite, (GACA) _n - and (TCC) _n -microsatellite loci on the formation of within-population gene diversity in parthenogenetic species D. dahli and D. armeniaca were shown to be different. The equality of the realized gene diversity Hand its maximum possible value H _max in two populations of D. dahli (H _max = 0.032, H = 0.031, P 0.0431; H _max = 0.024, H = 0.027, P = 0.09) and D. armeniaca (H _max = 0.05, H = 0.053, P = 0.03; H _max= 0.054, H = 0.055, P= 0.02) suggests that variation in (GACA) _n loci substantially contributes to the maintenance of within-population genetic diversity. Analysis of between-population genetic diversity using loci M13, (GACA) _n , and (TCC) _n showed differentiation of D. dahli populations from northeastern and northwestern Armenia (F _ST = 0.0272, P = 3 × 10^–13) and genetic homogeneity of the Armenian and introduced to the Ukraine populations of D. armeniaca characteristic of one clone (F _ST = 0, P = 1).     

Heterochromatin and microsatellites detection in karyotypes of four sea turtle species: Interspecific chromosomal differences

The wide variation in size and content of eukaryotic genomes is mainly attributed to the accumulation of repetitive DNA sequences, like microsatellites, which are tandemly repeated DNA sequences. Sea turtles share a diploid number (2n) of 56, however recent molecular cytogenetic data have shown that karyotype conservatism is not a rule in the group. In this study, the heterochromatin distribution and the chromosomal location of microsatellites (CA)_n, (GA)_n, (CAG)_n, (GATA)_n, (GAA)_n, (CGC)_n and (GACA)_n in Chelonia mydas, Caretta caretta, Eretmochelys imbricata and Lepidochelys olivacea were comparatively investigated. The obtained data showed that just the (CA)_n, (GA)_n, (CAG)_n and (GATA)_n microsatellites were located on sea turtle chromosomes, preferentially in heterochromatic regions of the microchromosomes (mc). Variations in the location of heterochromatin and microsatellites sites, especially in some pericentromeric regions of macrochromosomes, corroborate to proposal of centromere repositioning occurrence in Cheloniidae species. Furthermore, the results obtained with the location of microsatellites corroborate with the temperature sex determination mechanism proposal and the absence of heteromorphic sex chromosomes in sea turtles. The findings are useful for understanding part of the karyotypic diversification observed in sea turtles, especially those that explain the diversification of Carettini from Chelonini species.