Zygosity Determination in Hairless Mice by PCR Based on Hrhr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr^hr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr^hr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr^hr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr^hr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr^hr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.     

Adam10 haploinsufficiency causes freckle-like macules in Hairless mice

The Hairless nuclear receptor co‐repressor is required for hair follicle regeneration during the hair cycle. The classical Hairless^Hr/Hairless^Hr mouse mutant loses all hair between 2 and 3 weeks of age. As the mice age, their trunk skin develops epidermal pigmentation, a feature of human skin which is not found in normal haired mice. In this report, we present a new, dominant mouse mutation, Pied, which arose within a colony of Hairless^Hr/Hairless^Hr mice and causes freckle‐like macules on the skin. The Pied macules require Hairless^Hr homozygosity to form and are composed of localized clusters of epidermal melanocytes. Through linkage analysis, we find that the Pied mutation is a 1914 base pair loss‐of‐function deletion in the Adam10 zinc metalloprotease gene. The pathways that specifically maintain long‐term pigmentation patterns in adults are not well understood. We have identified Adam10 as an inhibitor of melanocyte expansion in adult skin.     

Molecular Basis for the rhino (hr)Phenotype: A Nonsense Mutation in the MousehairlessGene

The hairless (hr) and rhino (hr^rh) mutations are autosomal recessive allelic mutations that map to mouse Chromosome 14. Both hairless and rhino mice have a number of skin and nail abnormalities and develop a striking form of total alopecia at approximately 3–4 weeks of age. The molecular basis of the hairless mouse phenotype was previously found to be the result of a murine leukemia proviral insertion in intron 6 of thehrgene that resulted in aberrant splicing. In this study, we report a 2-bp substitution in exon 4 of thehrgene in a second allele ofhr,rhino 8J (hr^rh-8J), leading to a nonsense mutation. These findings document the molecular basis of the rhino phenotype for the first time and suggest that rhino is a functional knock-out of thehrgene.     

Immunohistochemical comparison of whisker pad cutaneous innervation in Swiss Webster and hairless mice

To establish the mouse mutant, hairless (Hr), as a useful model for future analyses of target–ending interactions, we assessed the cutaneous innervation in the whisker pad after loss of primary hair targets. Postnatal (P) development of fur in Hr begins similarly to that of “normal” Swiss Webster (SW) mice. Around P10, hairs are shed and the follicles rendered permanently incompetent. Hair loss progresses rostrocaudally until the entire skin is denuded. Substantial alterations in the distribution and density of sensory and autonomic endings in the mystacial pad vibrissal and intervibrissal fur innervation were discovered. Pilo-neural complexes innervating fur hairs were dismantled in Hr. Epidermal innervation in SW was rich; only a few endings expressed growth-associated protein-43?kdal (GAP), suggesting limited changes in axonal elongation. Innervation in Hr formed a dense layer passing upward through the thickened epidermis, with substantial increases among all types of endings. Vibrissal follicle–sinus complexes were also hyperinnervated. Endings in Hr vibrissae and fur were strongly GAP-positive, suggesting reorganization of innervation. Dermal and vascular autonomic innervation in both strains co-localized tyrosine hydroxylase and neuropeptide Y, but only in Hr did neuropeptide Y co-localize calcitonin gene-related peptide (CGRP) and express GAP immunolabeling. Stereological quantitation of trigeminal ganglia revealed no differences in neuron number between Hr and SW, although there were small increases in cell volume in Hr trigeminal ganglion cells. These results suggested that a form of collateral sprouting was active in Hr mystacial pads, not in response to local injury, but as a result of loss of primary target tissues.     

The Effects of Mutant Gene hairless in Chimeric Mice

The autosomal recessive gene hairless (hr) is responsible for the complete hairlessness in mice homozygous for this gene. Hair shedding that begins at the age of 10 days is caused by an abnormal cycle of hair follicle development disturbed at the catagen stage. This results in enhanced programmed cell death (apoptosis) and ultimately leads to the complete hair follicle destruction and shedding of all hairs by the age of three weeks. To study the phenotypic expression of the hr gene in a chimeric organism, we have obtained 12 chimeric mice hr/hr +/+ by means of aggregation of early embryos hr/hr and +/+. In chimeric mice, the hair shedding has begun two days later than in the hr/hr mice. By day 23 of postnatal development, hairless areas were present on the coat of chimeric mice or the latter were completely hairless depending on the percentage of the hr/hr mutant component. In four chimeras with high content of the mutant component (68–76%), the hair shedding process was similar to that in the hr/hr mice, though it was accomplished two days later. In three chimeras with 48–51% of the mutant component, alternating hairless and hair-covered bands were observed. These data suggest that the hr gene acts in epidermal cells of a hair follicle, because epidermal cell clones in embryonic skin migrate in the lateral–ventral direction coherently and without mixing. However, some chimeras displayed a pattern which was not so clear-cut: the band borders were illegible and hairs partly covered the hairless areas. In some chimeras, the uniform thinning of the coat was observed. Analysis of the effects of the hr mutant gene in chimeric mice differing in the ratio between mutant (hr/hr) and normal (+/+) components in tissues suggests that the hrgene acts in the epidermal cells of the hair follicle. The interactions between cells have an essential effect on the mode and degree of the hr gene expression, which leads to distortion of the ectodermal coat pattern in chimeras.     

A novel mutation in Hr causes abnormal hair follicle morphogenesis in hairpoor mouse, an animal model for Marie Unna Hereditary Hypotrichosis

Hairpoor mice (Hr ^Hp ) were derived through N-ethyl-N-nitrosourea (ENU) mutagenesis. These mice display sparse and short hair in the Hr ^Hp /+ heterozygous state and complete baldness in the Hr ^Hp /Hr ^Hp homozygous state. This phenotype was irreversible and was inherited in an autosomal semidominant manner. Hair follicles (HFs) of Hr ^Hp /+ mice underwent normal cycling and appeared normal, although smaller than those of the wild-type mice. In contrast, HFs of Hr ^Hp /Hr ^Hp mice became cyst-like structures by postnatal day (P) 21. The number and length of vibrissae decreased in a dose-dependent manner as the number of mutant alleles increased. A positional candidate gene approach was used to identify the gene responsible for the hairpoor phenotype. Genetic linkage analysis determined that the hairpoor locus is 2 cm from D14Mit34 on chromosome 14. Sequence analysis of the exons of the candidate gene hairless revealed a T-to-A transversion mutation at nucleotide position 403 (exon 2), presumably resulting in abolishment of an upstream open reading frame (uORF). In addition, we also found that the near-naked mouse (Hr ^N ), a spontaneously arising mutant, harbors a A402G transition in its genome. Both mutations were in the uATG codon of the second uORF in the 5′ UTR and corresponded to the mutations identified in Marie Unna Hereditary Hypotrichosis (MUHH) patients. In the present study we describe the phenotype, histological morphology, and molecular etiology of an animal model of MUHH, the hairpoor mouse. Electronic supplementary material  The online version of this article (doi:) contains supplementary material, which is available to authorized users. I. C. Baek and J. K. Kim contributed equally to this work.     

The ROSA26 LacZ-neo R insertion confers resistance to mammary tumors in Apc Min/+ mice

B6.129S7-Gtrosa26 (ROSA26) mice carry a LacZ-neo ^R insertion on Chromosome (Chr) 6, made by promoter trapping with AB1 129 ES cells. Female C57BL/6J Apc ^Min /+ (B6 Min/+) mice are very susceptible to the induction of mammary tumors after treatment with ethylnitrosourea (ENU). However, ENU-treated B6 mice carrying both Apc ^Min and ROSA26 are resistant to mammary tumor formation. Thus, ROSA26 mice carry a modifier of Min-induced mammary tumor susceptibility. We have previously mapped the modifier to a 4-cM interval of 129-derived DNA that also contains the ROSA26 insertion. Here we report additional evidence for the effect of the ROSA26 insertion on mammary tumor formation. To test the hypothesis that the resistance was due to a linked modifier locus, we utilized two approaches. We have derived and tested two lines of mice that are congenic for 129-derived DNA within the minimal modifier interval and show that they are as susceptible to mammary tumors as are B6 mice. Additionally, we analyzed a backcross population segregating for the insertion and show that mice carrying the insertion are more resistant to mammary tumor development than are mice not carrying the insertion. Thus, the resistance is not due to a 129-derived modifier allele, but must be due to the ROSA26 insertion. In addition, the effect of the ROSA26 insertion can be detected in a backcross population segregating for other mammary modifiers. Received: 29 December 2000 / Accepted: 4 April 2001     

Interaction of mutant genes Fgf5go-Y, we, and wal changes the duration of hair growth cycles in mice

Mutant gene wallhaarig (wa) was acting as a modifier of the mutant gene waved alopecia (wal), substantially increasing hair loss rate in mice, as was previously shown in our laboratory. The current paper is devoted to a study of mutant gene angora-Y (Fgf5 ^go-Y ), which had extended anagen stage of the first and second generations hair growth cycles in triple heterozygotes (Fgf5 ^go-Y /Fgf5 ^go-Y we/we wal/wal). First generation guard hair in triple homozygotes had their anagen stage 4 days longer than the same stage in double homozygotes (+/+ we/we wal/wal). Hair loss started at a catagen stage in double homozygotes, while it started in triple homozygotes at the end of the same stage or even in a telogen. Such mutant gene interaction in hair follicle morphogenesis led to a partial recovery of a body hair coat in triple homozygotes.     

The Patchwork Mouse Phenotype: Implication for Melanocyte Replacement in the Hair Follicle

Mice homozygous for the recessive patchwork (pwk) mutation are characterized by a variegated pigment pattern with a mixture of unpigmented and normally pigmented hairs. The pigmented hair bulbs contain functional melanocytes. By contrast, the unpigmented hair bulbs contain no melanocytes. This lack results from the death of melanoblasts in the hair follicle at the end of embryogenesis. Here, we report that melanoblasts and melanocytes are found in the epidermis of pwk/pwk mice. Furthermore, these epidermal pigment cells are able to colonize new hair follicles after skin wounding. Despite the presence of epidermal pigment cells with a colonization potential, a follicle that had produced an unpigmented hair produces a new unpigmented hair during the successive hair growth cycles. This hair color continuity is also true for the pigmented hair follicles. Thus, in normal conditions, the hair acts as an independent functional unit as regards its pigment cells population.     

Platelet sonicates activate hair follicle stem cells and mediate enhanced hair follicle regeneration

An increasing number of studies show that platelet‐rich plasma (PRP) is effective for androgenic alopecia (AGA). However, the underlying cellular and molecular mechanisms along with its effect on hair follicle stem cells are poorly understood. In this study, we designed to induce platelets in PRP to release factors by calcium chloride (PC) or by sonication where platelet lysates (PS) or the supernatants of platelet lysate (PSS) were used to evaluate their effect on the hair follicle activation and regeneration. We found that PSS and PS exhibited a superior effect in activating telogen hair follicles than PC. In addition, PSS injection into the skin activated quiescent hair follicles and induced K15⁺ hair follicle stem cell proliferation in K14‐H2B‐GFP mice. Moreover, PSS promoted skin‐derived precursor (SKP) survival in vitro and enhanced hair follicle formation in vivo. In consistence, protein array analysis of different PRP preparations revealed that PSS contained higher levels of 16 growth factors (out of 41 factors analysed) than PC, many of them have been known to promote hair follicle regeneration. Thus, our data indicate that sonicated PRP promotes hair follicle stem cell activation and de novo hair follicle regeneration.     

Agouti Alleles Influence Thiol Concentrations in Hair Follicles and Extrafollicular Tissues of Mice (Ay/a,AwJ/AwJ,a/a)

Agouti protein (AP) expression in the wild-type agouti mouse (A^wJ/A^wJ) coincides with a switch in hair follicle melanogenesis from black (eumelanin) to yellow (pheomelanin). Ectopic overexpression of AP in the lethal yellow (A^y/a) mouse cause a pure yellow coat and the lethal yellow syndrome. Thiol concentrations may control the conversion of dopaquinone to pheomelanin in hair follicle melanocytes. Glutathione (GSH) also plays important roles in cellular health and protection. Using HPLC, cysteine and GSH were measured in 1) hair follicles, liver and serum of A^y/a, A^wJ/A^wJ, and a/a (black) mice, and 2) adipose and spleen tissues of A^y/a and a/a mice on day 9 of regenerating hair growth (late pheomelanin phase). Agouti locus alleles influence thiol metabolism in hair follicles and in other systemic tissues. A^y/a hair follicles and serum showed highest cysteine and lowest GSH levels. A^wJ/A^wJ mice showed intermediate levels, while a/a hair follicles and serum had lowest cysteine and highest GSH concentrations. In the hair follicle, cysteine (likely derived from enzymatic degradation of GSH) appears to be the primary pheomelanogenic thiol. Agouti locus alleles may also directly or indirectly affect thiol concentrations in systemic tissues like liver and spleen. Cysteine in spleen extracts showed A^y/a > a/a (P > 0.01). An A^y-induced imbalance of thiol metabolism (altering GSH concentrations in multiple tissues) may contribute to the pleiotropic defects of the lethal yellow syndrome.     

Dietary isoflavone increases insulin-like growth factor-I production, thereby promoting hair growth in mice

Sensory neurons release calcitonin gene-related peptide (CGRP) upon activation. We previously demonstrated that CGRP increases insulin-like growth factor-I (IGF-I) production in various tissues of mice including the skin. We demonstrated that isoflavone increases the CGRP synthesis in the dorsal root ganglion (DRG) neurons in rats. Since IGF-I plays a critical role in hair growth, we hypothesized that isoflavones may promote hair growth by increasing the IGF-I production in hair follicles. We examined this hypothesis using wild-type (WT) and CGRP-knockout (CGRP^−/−) mice. Isoflavone significantly increased the CGRP mRNA levels in DRG neurons isolated from WT mice (P<.01). Administration of isoflavone for 3 weeks increased the dermal levels of CGRP, IGF-I and IGF-I mRNA in WT mice, but not in CGRP^−/− mice. Isoflavone administration increased the immunohistochemical expression of IGF-I in hair follicle dermal papilla cells in WT mice. Significant enhancements of hair follicle morphogenesis, hair regrowth, and hair pigmentation were also observed in WT mice administered isoflavone. However, none of these effects in WT mice were observed in CGRP^−/− mice.These observations strongly suggest that isoflavone might increase IGF-I production in the hair follicle dermal papilla cells in mice through increasing CGRP production in the sensory neurons, thereby promoting hair growth associated with melanogenesis in mice.     

Gene <Emphasis Type="Italic">angora</Emphasis> as a modifier of the <Emphasis Type="Italic">hairless</Emphasis> gene in mouse

The interaction between mouse angora-Y (Fgf5 ^go-Y) and hairless (hr) genes have been studied. Homozygous mutant gene Fgf5 ^go-Y increases length of all hair types, while homozygotes for the h gene lose hair completely starting on day 14 after birth. We obtained mice with genotypes +/+ hr/hr F₂, +/Fgf5 ^go-Y hr/hr and Fgf5 ^go-Y/Fgf5 ^go-Y hr/hr. Both +/Fgf5 ^go-Y hr/hr and +/+ hr/hr mice began to loose hair from their heads on day 14. This further extended on the whole body. On day 21 the mice were completely deprived of hair. Therefore a single dose of gene Fgf5 ^go-Y does not modify alopecia in mice homozygous for hr. However in double homozygotes Fgf5 ^go-Y/Fgf5 ^go-Y hr/hr alopecia started 4 days later, namely on day 18. It usually finished 10–12 days after detection of first bald patches. On days 28–30 double homozygotes lose coat completely. Hair loss in double homozygous mice was 1.5-fold slower than in +/+ hr/hr mice. This resulted from a significant extension of anagen phase induced by a mutant homozygous gene Fgf5 ^go-Y in morphogenesis of the hair follicle. The hr gene was expressed at the transmission phase from anagen to catagen. Our data shows that the angora gene is a modifier of the hairless gene and this results in a strong repression of alopecia progression in double homozygous mice compared to +/+ hr/hr animals.     

Extensive Hair Shaft Growth after Mouse Whisker Follicle Isolation,Cryopreservation and Transplantation in Nude Mice

We previously demonstrated that whole hair follicles could be cryopreserved to maintain their stem-cells differentation potential. In the present study, we demonstrated that cryopreserved mouse whisker hair follicles maintain their hair growth potential. DMSO better cryopreserved mouse whisker follicles compared to glycerol. Cryopreserved hair follicles also maintained the hair follicle-associated-pluripotent (HAP) stem cells, evidenced by P75^NTR expression. Subcutaneous transplantation of DMSO-cryopreserved hair follicles in nude mice resulted in extensive hair fiber growth over 8 weeks, indicating the functional recovery of hair shaft growth of cryopreserved hair follicles.     

Gene Expression and Localization of LAMTOR3 in the Skin Cells of Liaoning Cashmere Goats

Liaoning cashmere goats are the most precious genetic resources in China. The function of LAMTOR3 [late endosomal/lysosomal adaptor, mitogen-activated protein kinase (MAPK), and mammalian target of rapamycin activator 3/MAPK scaffold protein 1] gene is expressed in the skin of Liaoning cashmere goats. In situ hybridization (ISH) found that LAMTOR3 is expressed in the inner root sheath (IRS) of hair follicles. During the anagen or catagen phase, the expression of LAMTOR3 is higher in secondary hair follicles than in primary hair follicles. Expression of LAMTOR3 in skin cells treated with melatonin or insulin-like growth factor-1 (IGF-1) is lower than in untreated cells. In addition, the simultaneous treatment of fibroblast growth factor 5 and melatonin decrease the expression of LAMTOR3 in skin cells. The simultaneous treatment with melatonin and 10^?5?g/L IGF-1 or 10^?4?g/L IGF-1 increases the expression of LAMTOR3 gene in skin cells. If Noggin expression is decreased, then LAMTOR3 expression is increased. This hypothesis suggested that LAMTOR3 influences the character of cashmere fiber, and it may regulate the development of hair follicle and cashmere growth by inducing the MAPK signaling pathway.     

Independent regulation of hair and skin color by two G protein‐coupled pathways

Hair color and skin color are frequently coordinated in mammalian species. To explore this, we have studied mutations in two different G protein coupled pathways, each of which affects the darkness of both hair and skin color. In each mouse mutant (Gnaq^Dsk1, Gna11^Dsk7, and Mc1r^e), we analyzed the melanocyte density and the concentrations of eumelanin (black pigment) and pheomelanin (yellow pigment) in the hair or skin to determine the mechanisms regulating pigmentation. Surprisingly, we discovered that each mutation affects hair and skin color differently. Furthermore, we have found that in the epidermis, the melanocortin signaling pathway does not couple the synthesis of eumelanin with pheomelanin, as it does in hair follicles. Even by shared signaling pathways, hair and skin melanocytes are regulated quite independently.     

Co-factors of LIM domains (Clims/Ldb/Nli) regulate corneal homeostasis and maintenance of hair follicle stem cells

The homeostasis of both cornea and hair follicles depends on a constant supply of progeny cells produced by populations of keratin (K) 14-expressing stem cells localized in specific niches. To investigate the potential role of Co-factors of LIM domains (Clims) in epithelial tissues, we generated transgenic mice expressing a dominant-negative Clim molecule (DN-Clim) under the control of the K14 promoter. As expected, the K14 promoter directed high level expression of the transgene to the basal cells of cornea and epidermis, as well as the outer root sheath of hair follicles. In corneal epithelium, the transgene expression causes decreased expression of adhesion molecule BP180 and defective hemidesmosomes, leading to detachment of corneal epithelium from the underlying stroma, which in turn causes blisters, wounds and an inflammatory response. After a period of epithelial thinning, the corneal epithelium undergoes differentiation to an epidermis-like structure. The K14-DN-Clim mice also develop progressive hair loss due to dysfunctional hair follicles that fail to generate hair shafts. The number of hair follicle stem cells is decreased by at least 60% in K14-DN-Clim mice, indicating that Clims are required for hair follicle stem cell maintenance. In addition, Clim2 interacts with Lhx2 in vivo, suggesting that Clim2 is an essential co-factor for the LIM homeodomain factor Lhx2, which was previously shown to play a role in hair follicle stem cell maintenance. Together, these data indicate that Clim proteins play important roles in the homeostasis of corneal epithelium and hair follicles.     

Ontogeny of enhancing factor in mouse intestines and skin

Summary Enhancing Factor (EF) is a 14 kDa protein isolated from mouse small intestines, which enhances the binding of ¹²⁵I-EGF to A431 cells. This observation as well as our earlier in vitro studies have indicated that EF is a modulator of EGF. In adult mice, localization of EF by immunohistochemistry shows it is present pre-dominantly in the Paneth cells of the small intestines and to a lesser extent in the stomach and colon. This study of the ontogeny of EF shows that the appearance of the protein coincides with the appearance of mature Paneth cells. In new born mouse skin EF is localized in the hair follicles in the first hair cycle from day 2 to day 8. It is however absent in the adult skin. Thus EF is associated with tissues which have a high growth rate.     

The ret oncogene can induce melanogenesis and melanocyte development in W/W mice

We recently reported the establishment of transgenic mouse lines carrying the mouse metallothionein/ret fusion gene in which severe melanosis and melanocytic tumors developed. In the present study, we demonstrate that a significant number of pigmented hairs developed in W^v/W^v mice crossed to one of the transgenic mouse lines. The pigmented hair of W^v/W^v mice carrying the ret oncogene did not lose color during aging and reappeared after shaving, indicating that the melanocytes in the hair follicle function. The melanocytic tumors also developed in these mice, although the incidence was lower than that in the wild transgenic mice. Furthermore, the neural tube culture of mouse embryos indicated that neural crest cells of the transgenic mice gave rise to a cell population that autonomously produced melanin even in the absence of melanocyte stimulating hormone. These results strongly suggested that the introduced ret oncogene could compensate for the defect of c-kit in W^v mice during both embryogenesis and postnatal life and induce a high level of melanin synthesis in the process of melanocyte development.