Identification of the RNA products of the ops gene of Myxococcus xanthus and mapping of ops and tps RNAs.

The expression of the ops gene, like that of the highly homologous and closely linked tps gene, is induced during development of the fruiting bacterium Myxococcus xanthus. The RNA products of the ops gene have been identified and compared with tps RNA. The ops RNA was observed in developmental cells only after spore formation had commenced, and it was necessary to use a sporulation-defective mutant strain or to disrupt spores to isolate this RNA. RNA from the ops gene was not observed in vegetative cells but was readily detected in cells subjected to glycerol-induced sporulation. In contrast, a large amount of developmental tps RNA was observed in cells well before sporulation had occurred; low levels of tps RNA were observed in vegetative cells; and only a slight increase in tps RNA was found during glycerol-induced sporulation. Several ops and tps RNAs were observed in this study, and the positions of these RNAs were mapped on the M. xanthus genome. The 5' ends of both the ops and tps RNAs mapped predominantly to positions about 50 bases upstream from the respective translational initiation sites. The 3' ends of RNAs from both genes were heterogeneous. The four ops RNAs were 620, 775, 845, and 1,230 bases in length, while the tps RNAs were 612, 695, 730, and 935 bases.     

Differential expression of protein S genes during Myxococcus xanthus development

Protein S, the most abundant protein synthesized during development of the fruiting bacterium Myxococcus xanthus, is coded by two highly homologous genes called protein S gene 1 (ops) and protein S gene 2 (tps). The expression of these genes was studied with fusions of the protein S genes to the lacZ gene of Escherichia coli. The gene fusions were constructed so that expression of beta-galactosidase activity was dependent on protein S gene regulatory sequences. Both the gene 1-lacZ fusion and the gene 2-lacZ fusion were expressed exclusively during fruiting body formation (development) in M. xanthus. However, distinct patterns of induction of fusion protein activity were observed for the two genes. Gene 2 fusion activity was detected early during development on an agar surface and could also be observed during nutritional downshift in dispersed liquid culture. Gene 1 fusion activity was not detected until much later in development and was not observed after downshift in liquid culture. The time of induction of gene 1 fusion activity was correlated with the onset of sporulation, and most of the activity was spore associated. This gene fusion was expressed during glycerol-induced sporulation when gene 2 fusion activity could not be detected. The protein S genes appear to be members of distinct regulatory classes of developmental genes in M. xanthus.     

Two homologous genes coding for spore-specific proteins are expressed at different times during development of Myxococcus xanthus.

The ops and tps genes of Myxococcus xanthus have ca. 90% DNA and amino acid sequence homology and are in the same orientation separated by a spacer region of only 1.4 kilobases. The products of the two genes were found to cross-react immunologically, and both were capable of Ca2+-dependent self-assembly on the surface of myxospores. However, the ops and tps genes were expressed very differently during the developmental cycle of M. xanthus. The tps gene is induced early during fruiting body formation on a solid surface, and its product, protein S, is made in large quantities (up to 15% of total protein synthesis). When the cells turn into myxospores, protein S is assembled on the outer surface of the spore. We have now also found it in much smaller quantities inside the spores. The ops gene, on the other hand, appears to be induced later in development, after the cells have sporulated, since the ops gene product was found only inside the spores. When an ops gene under the control of a tps gene promoter was inserted into a wild-type strain, the ops gene product was synthesized at the same time as protein S and assembled onto the spore surface.     

Effects of deletion of the gene for the development-specific protein S on differentiation in Myxococcus xanthus

A deletion mutation of the gene for protein S (tps), a development-specific protein of Myxococcus xanthus, was constructed. No significant differences in the process of fruiting body formation or the yield of myxospores were observed between mutant and wild-type cells. On the other hand, when the tps gene was deleted together with a 2.0-kilobase sequence including the ops gene immediately upstream of the tps gene, fruiting body formation was substantially delayed, and the yield of myxospores was reduced. These results indicate that protein S is not essential for differentiation of M. xanthus, whereas a gene product(s) coded from the sequence upstream of the tps gene appears to be required for normal fruiting body formation.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Positive and negative DNA elements of the Drosophila grimshawi s18 chorion gene assayed in Drosophila melanogaster.

Germ line transformation has been used to map the cis regulatory DNA elements responsible for the precise and evolutionarily stable developmental expression of the s18 chorion gene. Constructs containing chimeric combinations of Drosophila melanogaster and D. grimshawi DNA regions, as well as D. grimshawi sequences alone, can direct expression in the follicular epithelium, in an s18-specific temporal and spatial pattern. The results indicate that both positive and negative regulatory elements can function when transferred from D. grimshawi to D. melanogaster. The first ca. 100 bp of the 5'-flanking DNA region constitute a minimal, developmentally regulated promoter, expression of which is inhibited by the next 100-bp DNA segment and activated by positive elements located further upstream. Expression of the minimal promoter can also be enhanced by more distant chorion regulatory elements, provided the inhibitory DNA segment is absent.     

Regulation of dev, an operon that includes genes essential for Myxococcus xanthus development and CRISPR-associated genes and repeats

Expression of dev genes is important for triggering spore differentiation inside Myxococcus xanthus fruiting bodies. DNA sequence analysis suggested that dev and cas (CRISPR-associated) genes are cotranscribed at the dev locus, which is adjacent to CRISPR (clustered regularly interspaced short palindromic repeats). Analysis of RNA from developing M. xanthus confirmed that dev and cas genes are cotranscribed with a short upstream gene and at least two repeats of the downstream CRISPR, forming the dev operon. The operon is subject to strong, negative autoregulation during development by DevS. The dev promoter was identified. Its -35 and -10 regions resemble those recognized by M. xanthus sigma(A) RNA polymerase, the homolog of Escherichia coli sigma(70), but the spacer may be too long (20 bp); there is very little expression during growth. Induction during development relies on at least two positive regulatory elements located in the coding region of the next gene upstream. At least two positive regulatory elements and one negative element lie downstream of the dev promoter, such that the region controlling dev expression spans more than 1 kb. The results of testing different fragments for dev promoter activity in wild-type and devS mutant backgrounds strongly suggest that upstream and downstream regulatory elements interact functionally. Strikingly, the 37-bp sequence between the two CRISPR repeats that, minimally, are cotranscribed with dev and cas genes exactly matches a sequence in the bacteriophage Mx8 intP gene, which encodes a form of the integrase needed for lysogenization of M. xanthus.