共查询到20条相似文献,搜索用时 15 毫秒
1.
Simone Haeberlein Dominik Fischer Stephanie Margarete Thomas Ulrike Schleicher Carl Beierkuhnlein Christian Bogdan 《PloS one》2013,8(11)
Leishmaniasis is caused by protozoa of the genus Leishmania and transmitted by sand flies from mammalian reservoirs to humans. In recent years, a northward spread of L. infantum from highly endemic Mediterranean countries into previously non-endemic Central European areas has been suspected based on presumed sporadic cases of autochthonous leishmaniasis. Here, we investigated whether sand flies are prevalent in Bavaria in Southern Germany, a federal state in which autochthonous cases have previously been reported. Considering the present and future climatic conditions, we determined whether Bavaria is suitable for five sand fly species with assumed spreading tendencies towards Central Europe: Phlebotomus ariasi, P. neglectus, P. perfiliewi and P. perniciosus that are known vectors for Leishmania in Europe, and P. mascittii, a suspected but not proven vector. Within Bavaria we defined sampling regions based on their climatic suitability and their spatial distance to the sites of the autochthonous cases and/or to areas of reported sand fly detection in states adjacent to Bavaria. At 155 locations in 7 sampling regions, CDC light traps were placed during 38 nights in the summers of 2009 and 2010, resulting in 202 trap-nights. All traps were negative for sand flies. The results suggest that Bavaria is not yet endemic for sand flies, but do not exclude the possibility of sporadic cases of autochthonous human or zoonotic Leishmania infections. This study, which combined methodological approaches from different disciplines, serves as reference for future surveys and risk analyses of sand flies and leishmaniasis in so far non-endemic areas of Europe. 相似文献
2.
K.S. Calabrese V.M.C.L. Cortada M.A.A. Souza Lima C.S.F. Souza L.O.P. Carvalho A.L. Abreu-Silva 《Experimental parasitology》2010,124(3):253-257
In the New World, visceral leishmaniasis (VL), which is a progressive disease and frequently fatal, is caused by Leishmania (Leishmania) infantum/chagasi. It is endemic in many regions of Brazil and occasionally occurs in non-endemic regions when dogs from an endemic area are introduced. The aim of the present study is to compare different skin infection patterns of dogs from two leishmaniasis endemic areas. A histological analysis of dogs from Campo Grande, Mato Grosso do Sul state, a region where epidemic episodes are currently taking place, showed dermic inflammatory infiltrates, composed of numerous vacuolated parasitized macrophages, few lymphocytes, plasma cells and many degranulated mast cells. In the other region of the study, São Luís, Maranhão state, the skin of dogs presented a remarkable inflammatory reaction composed mainly of plasma cells, lymphocytes and very few parasites. We concluded that there is a difference in the skin lesion patterns of dogs with leishmaniasis that is directly related to the endemic area where the animals live. 相似文献
3.
Olga Brandonisio Rosa Spinelli Maria Pepe 《Microbes and infection / Institut Pasteur》2004,6(15):1402
Dendritic cells (DCs) are key elements of the immune system, which function as sentinel in the periphery and alert T lymphocytes about the type of invading antigen and address their polarisation, in order to mount an efficacious immune response. Leishmania spp. are parasitic protozoa which may cause severe disease in humans and domestic animals. In this work, the main studies concerning the role of DCs in Leishmania infection are reviewed, in both the murine and human models. In particular, the importance of the genetic status of the hosts and of the different Leishmania species in modulating DC-mediated immune response is examined. In addition, different approaches of DC-based vaccination against experimental leishmaniasis, which could have important future applications, are summarised. 相似文献
4.
M. Pombi A. Giacomi G. Barlozzari J. Mendoza-Roldan G. Macrì D. Otranto S. Gabrielli 《Medical and veterinary entomology》2020,34(4):470-475
The detection of atypical Kinetoplastida in vertebrate hosts and vectors might suggest unexpected host-parasite contacts. Aside to major vectors of Leishmania (Leishmania) infantum in Italy (e.g. Phlebotomus perniciosus and Phlebotomus perfiliewi), the sand fly fauna also includes Sergentomyia minuta, herpetophilic and proven vector of Leishmania (Sauroleishmania) tarentolae, in which records of blood meal on mammals and detection of L. infantum DNA are increasing. This study was conducted in Central Italy aiming to molecularly detect potential atypical Leishmania host-vector contacts. Detection of Leishmania spp. DNA was performed by polymerase chain reaction (SSU rRNA, ITS1 targets) on field-collected sand fly females (N = 344), blood samples from humans (N = 185) and dogs (N = 125). Blood meal identification was also performed on engorged sand flies. Leishmania spp. DNA was found in 13.1% sand flies, 3.7% humans and 14.4% dogs. Sequence analysis identified L. infantum in S. minuta (4.4%), P. perniciosus (9.1%), humans (2.2%) and dogs (14.4%). Leishmania tarentolae was detected in S. minuta (12.6%), P. perfiliewi (6.6%) and human (1.6%) samples. Of 28 S. minuta examined for blood meal, 3.6 and 21.4% scored positive for human and lizard DNA, respectively. These results indicate the importance of one-health approach to explore new potential routes of transmission of leishmaniasis involving S. minuta. 相似文献
5.
Pranav Kumar Robert Lodge Frédéric Raymond Jean‐François Ritt Pascal Jalaguier Jacques Corbeil Marc Ouellette Michel J. Tremblay 《Molecular microbiology》2013,89(3):565-582
Drug resistance is a major public health challenge in leishmaniasis chemotherapy, particularly in the case of emerging Leishmania/HIV‐1 co‐infections. We have delineated the mechanism of cell death induced by the HIV‐1 protease inhibitor, Nelfinavir, in the Leishmania parasite. In order to further study Nelfinavir–Leishmania interactions, we selected Nelfinavir‐resistant axenic amastigotes in vitro and characterized them. RNA expression profiling analyses and comparative genomic hybridizations of closely related Leishmania species were used as a screening tool to compare Nelfinavir‐resistant and ‐sensitive parasites in order to identify candidate genes involved in drug resistance. Microarray analyses of Nelfinavir‐resistant and ‐sensitive Leishmania amastigotes suggest that parasites regulate mRNA levels either by modulating gene copy numbers through chromosome aneuploidy, or gene deletion/duplication by homologous recombination. Interestingly, supernumerary chromosomes 6 and 11 in the resistant parasites lead to upregulation of the ABC class of transporters. Transporter assays using radiolabelled Nelfinavir suggest a greater drug accumulation in the resistant parasites and in a time‐dependent manner. Furthermore, high‐resolution electron microscopy and measurements of intracellular polyphosphate levels showed an increased number of cytoplasmic vesicular compartments known as acidocalcisomes in Nelfinavir‐resistant parasites. Together these results suggest that Nelfinavir is rapidly and dramatically sequestered in drug‐induced intracellular vesicles. 相似文献
6.
Canine visceral leishmaniasis caused by Leishmania infantum in Senegal: risk of emergence in humans?
B. Faye A.L. Bañuls B. Bucheton M.M. Dione O. Bassanganam M. Hide J. Dereure M. Choisy J.L. Ndiaye O. Konaté M. Claire M.W. Senghor M.N. Faye I. Sy A.A. Niang J.F. Molez K. Victoir P. Marty P. Delaunay R. Knecht O. Gaye 《Microbes and infection / Institut Pasteur》2010,12(14-15):1219-1225
In the context of global warming and the risk of spreading arthropod-borne diseases, the emergence and reemergence of leishmaniasis should not be neglected. In Senegal, over the past few years, cases of canine leishmaniasis have been observed. We aim to improve the understanding of the transmission cycle of this zoonosis, to determine the responsible species and to evaluate the risk for human health. An epidemiological and serological study on canine and human populations in the community of Mont Rolland (Thiès area) was conducted. The data showed a high seroprevalence of canine leishmaniasis (>40%) and more than 30% seropositive people. The dogs’ seroprevalence was confirmed by PCR data (concordance > 0.85, Kappa > 0.7). The statistical analysis showed strong statistical associations between the health status of dogs and seropositivity, the number of positive PCRs, clinical signs and the number of Leishmania isolates. For the first time, the discriminative PCRs performed on canine Leishmania strains clearly evidenced that the pathogenic agent is Leishmania infantum. The results obtained show that transmission of this species is well established in this area. That the high incidence of seropositivity in humans may be a consequence of infection with this species is discussed. 相似文献
7.
Diego Lins Guedes Alda Maria Justo Walter Lins Barbosa Júnior Elis Dionísio da Silva Samuel Ricarte de Aquino Manoel Sebastiao da Costa Lima Junior Ulisses Montarroyos Gilberto Silva Nunes Bezerra Amanda Virginia Batista Vieira Valria Rêgo Alves Pereira Zulma Maria de Medeiros 《PLoS neglected tropical diseases》2021,15(1)
BackgroundVisceral leishmaniasis (VL) in HIV-positive individuals is a global health problem. HIV-Leishmania coinfection worsens prognosis and mortality risk, and HIV-Leishmania coinfected individuals are more susceptible to VL relapses. Early initiation of antiretroviral therapy can protect against Leishmania infection in individuals living in VL-endemic areas, and regular use of antiretrovirals might prevent VL relapses in these individuals. We conducted a cross-sectional study in Petrolina, Brazil, an VL-endemic area, to estimate the prevalence of asymptomatic Leishmania cases among HIV-positive outpatients.MethodsWe invited any HIV-positive patients, aged ≥ 18-years-old, under antiretroviral therapy, and who were asymptomatic for VL. Patients were tested for Leishmania with enzyme-linked immunosorbent assays (ELISA)-rK39, immunochromatographic test (ICT)-rK39, direct agglutination test (DAT), latex agglutination test (KAtex), and conventional polymerase chain reaction (PCR). HIV-Leishmania coinfection was diagnosed when at least one VL test was positive.ResultsA total of 483 patients were included. The sample was predominantly composed of single, < 48-years-old, black/pardo, heterosexual males, with fewer than 8 years of schooling. The prevalence of asymptomatic HIV-Leishmania coinfection was 9.11% (44/483). HIV mono-infected and HIV-Leishmania coinfected groups differed statistically significantly in terms of race (p = 0.045), marital status (p = 0.030), and HIV viral load (p = 0.046). Black/pardo patients, married patients, and those with an HIV viral load up to 100,000 copies/ml presented higher odds for HIV-Leishmania coinfection.ConclusionsA considerable number of asymptomatic Leishmania cases were observed among HIV-positive individuals in a VL-endemic area. Given the potential impact on transmission and health costs, as well as the impact on these coinfected individuals, studies of asymptomatic Leishmania carriers can be useful for guiding public health policies in VL-endemic areas aiming to control and eliminate the disease. 相似文献
8.
Sereno D Vanhille L Vergnes B Monte-Allegre A Ouaissi A 《Kinetoplastid biology and disease》2005,4(1):1
Background
In yeast and Caenorhabditis elegans, Silent Information Regulator (SIR2) proteins have been shown to be involved in ageing regulation. In Leishmania, the LmSIR2rp was originally isolated from the excreted/secreted material of the Leishmania parasites. Among the function(s) of this protein in Leishmania biology, we have documented its implication in parasite survival, and in particular in Leishmania amastigotes. In this paper we question the role of the excreted/secreted form of the protein. In particular we wonder if the Leishmania Sir2 homologue is involved in some aspect of its biological function(s), in various components and pathways, which could promote the host cell survival. To test this hypothesis we have mimicked an intracellular release of the protein through constitutive expression in mouse L929 fibrosarcoma cells. 相似文献9.
Leishmaniasis is a worldwide problem and has been neglected in a wide range of fields, from diagnosis to treatment. This report describes a case of mucosal leishmaniasis, which may developped after seven decades of an inadequately treated cutaneous lesion. A female patient, 79 years old, from the non-endemic area for leishmaniasis in northern Paraná, presenting mucosal lesion in the nose and throat, reported an “angry ulcer” treated inappropriately as a child when she lived in an endemic region of the state of São Paulo. Indirect immunofluorescence and direct parasite screening were positive. Polymerase chain reaction detected a parasite belonging to the subgenus Leishmania (Viannia) sp. Due to patients limitations, such as low weight and advanced age, the therapeutic model adopted was the combined small doses of Glucantime™ to pentoxifylline, which ensured treatment success. 相似文献
10.
Bego?a Monge-Maillo Francesca F. Norman Israel Cruz Jorge Alvar Rogelio López-Vélez 《PLoS neglected tropical diseases》2014,8(8)
Visceral leishmaniasis is hypoendemic in Mediterranean countries, where it is caused by the flagellate protozoan Leishmania infantum. VL cases in this area account for 5%–6% of the global burden. Cases of Leishmania/HIV coinfection have been reported in the Mediterranean region, mainly in France, Italy, Portugal, and Spain. Since highly active antiretroviral therapy was introduced in 1997, a marked decrease in the number of coinfected cases in this region has been reported. The development of new diagnostic methods to accurately identify level of parasitemia and the risk of relapse is one of the main challenges in improving the treatment of coinfected patients. Clinical trials in the Mediterranean region are needed to determine the most adequate therapeutic options for Leishmania/HIV patients as well as the indications and regimes for secondary prophylaxis. This article reviews the epidemiological, diagnostic, clinical, and therapeutic aspects of Leishmania/HIV coinfection in the Mediterranean region. 相似文献
11.
Modeling of leishmaniasis infection dynamics: novel application to the design of effective therapies
Bettina M L?nger Cristina Pou-Barreto Carlos González-Alcón Basilio Valladares Bettina Wimmer Néstor V Torres 《BMC systems biology》2012,6(1):1
Background
The WHO considers leishmaniasis as one of the six most important tropical diseases worldwide. It is caused by parasites of the genus Leishmania that are passed on to humans and animals by the phlebotomine sandfly. Despite all of the research, there is still a lack of understanding on the metabolism of the parasite and the progression of the disease. In this study, a mathematical model of disease progression was developed based on experimental data of clinical symptoms, immunological responses, and parasite load for Leishmania amazonensis in BALB/c mice. 相似文献12.
DAVID M. IOVANNISCI C. PAUL PLESTED GREGORY R. MOE 《The Journal of eukaryotic microbiology》2010,57(5):405-414
ABSTRACT. Leishmania parasites, which afflict 12 million people in 88 countries, exist as promastigotes transmitted by insect vectors and as amastigotes residing in mammalian macrophages. Promastigote cells arranged in rosettes have also been described but universally disregarded as a distinct stage in the life cycle. We present evidence that only rosettes of Leishmania major promastigotes express cell surface poly‐α2,8 N‐acetyl neuraminic acid (PSA) and PSA containing de‐N‐acetyl neuraminic acid (NeuPSA). Expression of rosette‐specific PSA antigens was mosaic, with individual promastigotes expressing PSA, NeuPSA or both. A 50 kDa protein was detected by Western blot analysis of a detergent‐insoluble cell fraction with both PSA and NeuPSA‐reactive antibodies. Frequencies of rosette formation as well as cell surface PSA/NeuPSA expression were temperature dependent. Rosettes also engaged in an unusual swarming behavior, congregating into extended clusters. Distinct structures resembling cellular fusion bodies were formed in and released from rosettes. The results indicate that rosettes are an unrecognized stage in the life cycle of Leishmania. We hypothesize that rosettes initiate mating in Leishmania during which PSA/NeuPSA expression plays an important role. Recognizing rosettes as a distinct form of the Leishmania life cycle opens new possibilities for treatment or prevention of disease and, possibly, in vitro genetic recombination without passage of cells through insect vectors. 相似文献
13.
Allahverdiyev AM Koc RC Ates SC Bagirova M Elcicek S Oztel ON 《Experimental parasitology》2011,(4):318-323
Leishmania parasites can be exposed to effects of light in their vectors and hosts, at various periods. However, there is no information about the effects of light on Leishmania parasites. The aim of this study is to investigate the effects of light on various cell parameters of Leishmania tropica, in vitro. All experiments were conducted on L. tropica promastigotes and amastigote-macrophage cultures, using flow cytometric analysis, MTT and phenol–sulfuric acid assay, DAPI and Giemsa. The results showed that the morphology of parasites has changed; the cell cycle has been affected and this caused parasites to remain at G0/G1 phase. Furthermore the proliferation, infectivity, glucose consumption and mitochondrial dehydrogenase activities of parasites were decreased. Thus, for the first time, in this study, the effects of light on biological activities of Leishmania parasites were shown. These new information about parasites’ biology, would be very important to investigate the effects of light on the parasites in infected vectors and hosts. 相似文献
14.
Antiparasitic effect of a lectin isolated from Synadenium carinatum latex (ScLL) was evaluated against Leishmania (Leishmania) amazonensis promastigotes/amastigotes. Pretreatment of murine inflammatory peritoneal macrophages with ScLL reduced by 65.5% the association index of macrophages and L. (L) amazonensis promastigotes. Expression of cytokines (IL-12, IL-1 and TNF-α) was detected in infected macrophages pretreated with ScLL (10 μg/mL). ScLL also reduced the growth of L. (L) amazonensis amastigote intracellular forms, showing no in vitro cytotoxic effects in mammalian host cells. ScLL treatment in infected murine inflammatory peritoneal macrophages did not induce nitric oxide production, suggesting that a nitric oxide independent pathway is activated to decrease the number of intracellular Leishmania. 相似文献
15.
Thomaz-Soccol V Velez ID Pratlong F Agudelos S Lanotte G Rioux JA 《Systematic parasitology》2000,46(1):59-68
Leishmaniasis is widespread in Colombia and is found in 30 of 32 Departments. More than 200 infection zones have been reported from different regions, which vary from sea-level to an altitude of 2,300 m along the Atlantic Coast, Pacific coast, Amazon basin, Cauca and Magdalena valleys. We report 76 Leishmania stocks isolated from humans, dogs and phlebotomine hosts. Isoenzyme electrophoresis revealed 16 zymodemes, which could be divided into four phylogenetic complexes, i.e., L. braziliensis, L. amazonensis, L. guyanensis/panamensis and L. infantum. Three zymodemes became integrated into the subgenus Leishmania and the other zymodemes into the subgenus Viannia. Cutaneous infections were due to the L. braziliensis (9.2%) and L. guyanensis/panamensis (85.54%) complexes. Mucous secondary involvement was due to the L. braziliensis and L. guyanensis/panamensis complexes. In this work the specific status of L. (V.) guyanensis and L. (V.) panamensis is discussed. 相似文献
16.
Goutam Mandal Srotoswati Mandal Mansi Sharma Karen Santos Charret Barbara Papadopoulou Hiranmoy Bhattacharjee Rita Mukhopadhyay 《PLoS neglected tropical diseases》2015,9(2)
Leishmania is a digenetic protozoan parasite causing leishmaniasis in humans. The different clinical forms of leishmaniasis are caused by more than twenty species of Leishmania that are transmitted by nearly thirty species of phlebotomine sand flies. Pentavalent antimonials (such as Pentostam or Glucantime) are the first line drugs for treating leishmaniasis. Recent studies suggest that pentavalent antimony (Sb(V)) acts as a pro-drug, which is converted to the more active trivalent form (Sb(III)). However, sensitivity to trivalent antimony varies among different Leishmania species. In general, Leishmania species causing cutaneous leishmaniasis (CL) are more sensitive to Sb(III) than the species responsible for visceral leishmaniasis (VL). Leishmania aquaglyceroporin (AQP1) facilitates the adventitious passage of antimonite down a concentration gradient. In this study, we show that Leishmania species causing CL accumulate more antimonite, and therefore exhibit higher sensitivity to antimonials, than the species responsible for VL. This species-specific differential sensitivity to antimonite is directly proportional to the expression levels of AQP1 mRNA. We show that the stability of AQP1 mRNA in different Leishmania species is regulated by their respective 3’-untranslated regions. The differential regulation of AQP1 mRNA explains the distinct antimonial sensitivity of each species. 相似文献
17.
Hamid Daneshvar Mohammad Javad Namazi Hossein Kamiabi Richard Burchmore Sarah Cleaveland Stephen Phillips 《PLoS neglected tropical diseases》2014,8(4)
An attenuated line of Leishmania infantum (L. infantum H-line) has been established by culturing promastigotes in vitro under gentamicin pressure. A vaccine trial was conducted using 103 naive dogs from a leishmaniosis non-endemic area (55 vaccinated and 48 unvaccinated) brought into an endemic area of southeast Iran. No local and/or general indications of disease were observed in the vaccinated dogs immediately after vaccination. The efficacy of the vaccine was evaluated after 24 months (4 sandfly transmission seasons) by serological, parasitological analyses and clinical examination. In western blot analysis of antibodies to L. infantum antigens, sera from 10 out of 31 (32.2%) unvaccinated dogs, but none of the sera from vaccinated dogs which were seropositive at >100, recognized the 21 kDa antigen of L. infantum wild-type (WT). Nine out of 31 (29%) unvaccinated dogs, but none of vaccinated dogs, were positive for the presence of Leishmania DNA. One out of 46 (2.2%) vaccinated dogs and 9 out of 31 (29%) unvaccinated dogs developed clinical signs of disease. These results suggest that gentamicin-attenuated L. infantum induced a significant and strong protective effect against canine visceral leishmaniosis in the endemic area. 相似文献
18.
Ahmad Mobed Parina Mehri Mohammad Hasanzadeh Ahad Mokhtarzadeh 《Journal of molecular recognition : JMR》2020,33(7)
The management of pathogen detection using a rapid and cost‐effective method presents a major challenge to the biological safety of the world. The field of pathogen detection is nascent and therefore, faces a dynamic set of challenges as the field evolves. Visceral leishmaniasis (VL), or kala‐azar is the most severe form of leishmaniasis. Delay to the accurate diagnosis and treatment is likely to lead to fatality. The reliable, fast and sensitive detection is closely linked to safe and effective treatment of Leishmania spp. Despite several routine and old method for sensitive and specificity detection of Leishmania spp, there is highly demand for developing modern and powerfully system. In this study a novel ultra‐sensitive DNA‐based biosensor was prepared for detection of Leishmania spp. For the first time, the specific and thiolated sequences of the Leishmania spp genome (5′‐SH‐[CH2]6 ATCTCGTAAGCAGATCGCTGTGTCAC‐3′) were recognized by electrochemical methods. Also, selectivity of the proposed bioassay was examined by three sequences that were mismatched in 1, 2, and 3 nucleotides. The linear range (10?6 to 10?21 M) and limit of detection (LLOQ = 1 ZM) obtained are remarkable in this study. Also, simple and cost‐effective construction of genosensors was another advantage of the proposal DNA‐based assay. The experimental results promise a fast and simple method in detection of kala‐azar patients with huge potential of the nanocomposite‐based probe for development of ideal biosensors. 相似文献
19.
J. Martin Sanchez F. Ruiz Martinez J. M. Salinas Martinez de Lecea C. Sanchez Rabasco C. Acedo Sanchez M. C. Sanchiz Marin V. Delgado Florencio F. Morillas Marquez 《Systematic parasitology》1996,33(3):177-182
This study presents the results of the characterisation of 17 strains ofLeishmania by isoenzyme electrophoresis from a focus of leishmaniasis in southern Spain: two from human visceral leishmaniasis, four from human cutaneous leishmaniasis and 11 from sandflies. The 17 strains are grouped in 6 zymodemes characterised by their variability as regards to the electrophoretic mobility of the enzymes MDH, G6PD, NP and ME. Thus, we confirm the high intraspecific variability ofLeishmania (L.) infantum in a focus of southern Spain, as already suggested by previous studies. Zymodemes GR-15 and GR-17 are also described for the first time in Spain, and they characteristically possess the same relative electrophoretic mobility in the enzyme ME (93). Sixteen zymodemes of theL. infantum complex found in southern Spain were numerically analysed on the basis of the enzymatic profiles of 122Leishmania strains characterised from this area. 相似文献
20.
A role for adenine nucleotides in the sensing mechanism to purine starvation in Leishmania donovani 下载免费PDF全文
Jessica L. Martin Phillip A. Yates Jan M. Boitz Dennis R. Koop Audrey L. Fulwiler Maria Belen Cassera Buddy Ullman Nicola S. Carter 《Molecular microbiology》2016,101(2):299-313
Purine salvage by Leishmania is an obligatory nutritional process that impacts both cell viability and growth. Previously, we have demonstrated that the removal of purines in culture provokes significant metabolic changes that enable Leishmania to survive prolonged periods of purine starvation. In order to understand how Leishmania sense and respond to changes in their purine environment, we have exploited several purine pathway mutants, some in which adenine and guanine nucleotide metabolism is uncoupled. While wild type parasites grow in any one of a variety of naturally occurring purines, the proliferation of these purine pathway mutants requires specific types or combinations of exogenous purines. By culturing purine pathway mutants in high levels of extracellular purines that are either permissive or non‐permissive for growth and monitoring for previously defined markers of the adaptive response to purine starvation, we determined that adaptation arises from a surveillance of intracellular purine nucleotide pools rather than from a direct sensing of the extracellular purine content of the environment. Specifically, our data suggest that perturbation of intracellular adenine‐containing nucleotide pools provides a crucial signal for inducing the metabolic changes necessary for the long‐term survival of Leishmania in a purine‐scarce environment. 相似文献