Studies on biosynthesis of tobacco mosaic virus. VII. Radioactivity of plus and minus strands in different forms of viral RNA after labelling of infected tobacco leaves

Tobacco leaves were labelled with tritiated undine for 30 or 120 minutes at different times after systemic infection with tobacco mosaic virus. RNA was extracted and separated into three fractions: one enriched in RF (replicative form), one enriched in RI (replicative intermediate), and one containing the bulk of single-stranded RNA. Radioactivity in plus strands (viral RNA) and minus strands (complementary RNA) was determined in each fraction by an isotope dilution assay. The amount of minus strands in the RP and RI fractions and the amount of plus strands in the single-stranded RNA fraction were also determined.Minus-strand synthesis was twice as high a few hours after the outbreak of visible symptoms as during the subsequent large accumulation of plus strands. At the early stage of virus production, the specific radioactivity of the minus strands was three- to fourfold that of the total RNA. Later it was about the same as that of the total RNA. As minus strands constitute a constant part of the total RNA at the later stages, this observation suggests that breakdown of minus strands is small.The specific radioactivity of minus strands was the same in corresponding RF and RI fractions. As the turn-over of minus strands appears to be small, a rapid interconversion of the two RNA types is indicated.In RF and RI the radioactivity in plus strands was between 6 and 50 times greater than that in minus strands. The specific radioactivity of plus strands was greater in RF and RI than in the single-stranded RNA, supporting the concept that both RF and RI have a precursor role for viral RNA.     

Fate of Tobacco Mosaic Virus after Entering the Host Cell

Tobacco leaves were inoculated with tobacco mosaic virus labeled with ³²P or ³⁵S. After various intervals, extracts of the leaves were prepared. In extracts from leaves infected for 5 to 360 min, about 40 to 60% of the virus retained on leaves was recovered in the pellet of the homogenate centrifuged at 12 000 × g. The virus associated with the 12 000 × g pellet was dissociable by treatment with pancreatic RNase, alkali or sodium dodecyl sulfate (SDS). The parental virus extracted by SDS from the pellet at 12 000 × g had a large amount of partially uncoated virus possessing naked RNA. Analysis by density gradient centrifugation suggested that, in addition to partially uncoated virus, some fragmented RNA was also associated with the 12 000 × g pellet. This fragmented RNA seemed to be derived from partially uncoated virus. Density gradient analysis of SDS extracts from the 12 000 × g pellet suggested that some of the virus underwent uncoating at the internal regions of the virus particle.     

Association of Viral Ribonucleic Acid with Cellular Membranes in Chick Embryo Cells Infected with Sindbis Virus

Membranes from cells infected with Sindbis virus had associated with them viral ribonucleic acid (RNA) polymerase and about 60 to 70% of the viral RNA labeled when short pulses were used. This RNA contained most of the replicative intermediate and replicative form of viral RNA found in the infected cells. The use of "Mg(2+) sarkosyl crystals" permitted the isolation of membrane-bound nucleic acids and allowed the demonstration that Sindbis virus RNA was synthesized on a membrane-viral RNA complex. Viral RNA from the infecting virions first became associated with the membranes during the latent period and, subsequently, slowly detached. The attachment of the viral RNA to the membranes did not require active viral RNA polymerase, since RNA from ts6, an RNA(-) temperature-sensitive mutant of Sindbis virus, associated with cellular membranes at a nonpermissive temperature. However, the subsequent detachment of the RNA from the membranes was restricted in the absence of viral RNA synthesis. The results indicate that association of viral RNA with cellular membranes may represent an early step occurring during the replication of Sindbis virus RNA.     

Unique nature of an attenuated strain of tobacco mosaic virus: autoregulation

An attenuated strain L11A of tobacco mosaic virus (TMV) multiplied like wild type strain L at an early stage of infection in tomato leaves. Four days after inoculation, however, multiplication of L11A was drastically reduced (autoregulation) compared with the constant multiplication of L. In mixed infections, L11A strongly inhibited the multiplication of homologous strain L. Experiments with cucumber mosaic virus (CMV) or tobacco plants revealed that the inhibitory mechanism of L11A is not host-specific but virus-specific, and the autoregulatory mechanism is effective only for TMV. RNA synthesis in L11A infected leaves 4 days after inoculation was studied by polyacrylamide gel electrophoresis. Synthesis of TMV-RNA and its replicative intermediate were strongly inhibited, whereas the replicative form of TMV-RNA and ribosomal RNA were synthesized as in the case of L infection. Synthesis of non-coat-protein was studied by the incorporation of radioactive histidine into subcellular fractions derived from leaves infected with L or L11A for 4 days. Different patterns of the two strains in protein synthesis were noted. At least three proteins were predominantly synthesized in L11A infection. One of them was observed in the mitochondria fraction. From its position in polyacrylamide gel, it could be viral coded 165K protein which is considered to be involved in viral RNA replication. These results suggest that the unique nature of attenuated virus L11A, i.e. autoregulation, resulted from the inhibitory mechanism of viral RNA synthesis due to overproduction of 165K protein and is quite distinct from interferon, intrinsic interference or interference by defective virus.     

Studies on the biosynthesis of TMV

Summary The replicative form and the replicative intermediate of TMV-RNA were isolated from synchronously infected tobacco leaves, labeled with H³-uridine for 1 hour. The replicative form is over 90% resistant to RNase and sediments slightly slower than the 16S ribosomal RNA. Sucrose gradient centrifugation of the thermally denatured replicative form revealed that it contains strands of the same size as single-stranded TMV-RNA. The replicative intermediate showed only partial resistance to RNase and heterogeneous sedimentation behavior in sucrose gradients. After mild RNase treatment the replicative intermediate sedimented homogeneously, and with an S value slightly lower than the replicative form.The following abbreviations are used RF replicative form - RI replicative intermediate - STE 0.1 M NaCl-1 mM Tris-HCl-1 mM EDTA, pH 7.4 - SSC 0.15 M NaCl-0.015 M sodium citrate, pH 7.0 - 10xSSC and 0.1xSSC tenfold concentrated and tenfold diluted SSC respectively - MAK methylated albumin coated kieselguhr     

Semliki Forest Virus-Specific RNAs Synthesized In Vitro by Enzyme from Infected BHK Cells

When Semliki Forest virus (SFV)-infected BHK cells were disrupted 4 h after infection, 75 to 90% of the total virus-specific RNA synthesizing enzyme was found in the large particle fraction, along with 75 to 90% of the in vivo-synthesized double-stranded RNAs. The RNA products of this enzyme-template complex in an in vitro system were double-stranded RNAs sedimenting predominantly at 18S, and single-stranded RNAs sedimenting at 42S, 26S, and 22S. The various virus-specific SFV RNAs synthesized in vitro were associated with different sized structures, and thus each was separable by differential centrifugation. Kinetic and pulse-chase experiments showed that the double-stranded RNAs were the precursors to the single-stranded RNAs. There were several double-stranded RNAs identified both in the in vitro product and also in extracts from infected cells. The major replicative form had a molecular weight of 4.4 × 10⁶.     

LOCALIZATION OF MACROMOLECULES IN ESCHERICHIA COLI : II. RNA and its Site of Synthesis

The distribution of RNA in cells of E. coli 15 T^-U^- labeled with uridine-H³ was studied by methods involving the analysis of radioautographic grain counts over random thin cross-sections and serial sections of the cells. The results were correlated with electron microscope morphological data. Fractionation and enzyme digestion studies showed that a large proportion of the label was found in RNA uracil and cytosine, the rest being incorporated as DNA cytosine. In fully labeled cells the distribution of label was found to be uniform throughout the cell. The situation remained unchanged when labeled cells were subsequently treated with chloramphenicol. When short pulses of label were employed a localization of a large proportion of the radioactivity became apparent. The nuclear region was identified as the site of concentration. Similar results were obtained when cells were exposed to much longer pulses of uridine-H³ in the presence of chloramphenicol. If cells were subjected to a short pulse of cytidine-H³, then allowed to grow for a while in unlabeled medium, the label, originally concentrated to some extent in the nuclear region, was found dispersed throughout the cell. The simplest hypothesis which accounts for these results is that a large fraction of the cell RNA is synthesized in a region in or near the nucleus and subsequently transferred to the cytoplasm.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

Incorporation of tritiated adenosine into mouse ovum RNA

The total RNA of ovulated mouse ova has been examined by polyacrylamide gel electrophoresis. The amount of RNA present in the two main peaks observed, 28 S and 18 S ribosomal RNA, has been estimated as 0.20 ng.The RNA of ovulated mouse ova was labeled by exposure of growing mouse oocytes to adenosine-8-³H in vivo. For this purpose a small volume of a concentrated solution of the precursor was injected into the ovarian bursa, and ova were collected by superovulation at various subsequent times. The major growth phase of the oocyte is known to lie between 20 and 6 days before ovulation. Significant incorporation into egg RNA was observed when bursal injection was performed between 19 and 7 days, but not between 5 days and 1 day before ovulation.The types of labeled RNA in ova ovulated at five intervals between 19 and 7 days after bursal injection of adenosine-8-³H or uridine-5,6-³H were analyzed by polyacrylamide gel electrophoresis. The distribution of label on the gels demonstrated that the bulk of the label appeared in ribosomal RNA and transfer RNA. In addition labeled heterogeneous RNA was estimated to represent 10–15% of the total incorporation.     

Effect of cordycepin triphosphate on in vitro RNA synthesis by plant viral replicases

In vitro RNA synthesis by tobacco mosaic virus and cowpea chlorotic mottle virus replicase were inhibited by cordycepin triphosphate. Inhibition could be overcome with higher concentrations of ATP in assay mixtures but not with UTP. Products synthesized in vitro by tobacco mosaic virus RNA replicase in the presence of inhibitor revealed replicative form but not replicative intermediate RNAs. These results suggest that cordycepin triphosphate competes specifically with ATP and results in premature termination of viral RNA synthesis in vitro.     

Characterization of Simian virus 40 DNA component II during viral DNA replication

Replicating molecules of Simian virus 40 DNA labeled during a short pulse with [³H]thymidine have been fractionated by ultracentrifugation methods and the open circular form (DNA component II) has been characterized. The pulse-labeled DNA component II is a relatively small constituent (1 to 3%) of the pool of replicating molecules. Examination of the circular (18 S) and linear (16 S) strands of DNA component II by alkaline sedimentation and by degradation using exonuclease III of Escherichia coli reveals that the newly synthesized DNA is principally in the linear strand. Cleavage of pulse-labeled DNA component II by an fi⁺, R-factor restriction endonuclease from E. coli demonstrates that the interruption in the pulse-labeled strand is specifically located at the termination point for replication.During a chase period of 20 minutes the amount of DNA component II increases to about 6 to 8% of the total labeled viral DNA. The kinetics of formation of superhelical, DNA component I and disappearance of replicative intermediates are linear during the chase period. After several hours of continuous labeling of replicating viral DNA, the DNA component II pool consists mainly of molecules labeled in both strands with the interruption non-specifically located in either strand. These molecules probably arise by the random introduction of single-strand breaks in newly synthesized DNA component I. During short periods of continuous labeling with [³H]thymidine, the ratio of DNA components I to II increases as a function of the pulse duration. These results support a model for 8V 40 DNA replication in which the open circular form is a precursor of the superhelical form.     

Studies on the biosynthesis of TMV

Summary It is shown by quantitative electron-microscopical analysis that veincleared leaves from plants systemically infected with TMV contain a majority of cells in the same stage of infection. Under defined environmental conditions the leaves which will show this synchronized virus synthesis can be determined at the time of inoculation. A standardized procedure for routine use of the system is described.The host-virus system has been used to investigate the sequential development of the virus-induced cytoplasmic differentiations and inclusion bodies. The rapid phase of virus particle formation commences at veinclearing and continues for about 40 hours. The first recognizable cytoplasmic change consists of a local branching and folding of the endoplasmic reticulum. This differentiation develops into the inclusion with diffuse, flexible rods found in late stages of infection together with the virus crystals.     

In situ detection of early replication phases of a gemini virus in legume protoplasts

Protoplasts of Phaseolus vulgaris L. (Top Crop), infected with bean golden mosaic virus, were isolated and fixed by various methods for in situ hybridization. An iodine-125 labeled probe was made from the replicative form of the virus. The localization and quantitation was done by autoradiography. Cell wall removal lowered the background and allowed a more accurate analysis. RNase was used to eliminate the possibility of hybrids to RNA. The evidence suggests a sequence of virus movements starting from rough endoplasm reticulum, moving to the nuclear membrane, and finally with the highest concentration inside the nucleus.Abbreviations BGMV bean golden mosaic virus - rfBGMV or rfDNA replicative double-stranded DNA virus - ssDNA single-stranded virus     

RNA synthesis in the ovary and oocytes of the starfish

Qualitative studies on the in vitro uptake and incorporation of tritiated uridine into RNA of the somatic and germinal elements of the starfish ovary were carried out prior to and during hormone-induced oocyte maturation and spawning.Autoradiography of nonhormone-treated ovaries indicated that the outer ovarian wall contained the highest concentration of label, with lesser amounts in the follicle cells and least in the oocytes. Oocytes and follicle cells localized at the periphery of the ovary were labeled first, and both cells became progressively labeled throughout the ovary with time; the label first appeared localized in the nucleolus of the oocyte.Sucrose gradient analysis of the separated cellular components of prelabeled hormone-treated ovaries indicated that RNA synthesis occurred in all segments of the ovary and that the spawned oocyte fraction was the least active. Synthesis of ribosomal RNA was detectable after a lag period of approximately 4 hr. Oocytes incubated in ³H-uridine during and subsequent to 1-methyladenine-induced spawning and maturation synthesized 15–19 S and low molecular weight RNA but not ribosomal RNA. Synthesis of the 15–19 S RNA was inhibited with ethidium bromide and to a limited extent by actinomycin D. Isolated mitochondrial fractions contained most of the labeled 15–19 S RNA. These data suggest the mitochondrial origin of most, if not all, of this intermediate-weight RNA. On the basis of these studies, it appears that starfish oocytes and follicle cells are metabolically active at the transitional period from growth to maturational stages in oocytes. Synthesis of RNA furthermore apparently continues in the cytoplasm subsequent to germinal vesicle breakdown and spawning.     

Nucleic Acid of Rubella Virus and Its Replication in Hamster Kidney Cells

Ribonucleic acid (RNA) has been isolated from partially purified rubella virus preparations and fractionated by rate zonal centrifugation in sucrose density gradients. The bulk of the RNA sedimented as a sharp band with a sedimentation coefficient of 38S. Rubella virus RNA appears to be single-stranded on the basis of its sensitivity to the degrading action of ribonuclease. Fractionation by precipitation with 1 m NaCl, followed by chromatography on cellulose columns, and by rate zonal centrifugation in sucrose density gradients of labeled RNA isolated from actinomycin D-treated and infected baby hamster kidney cells revealed the presence of the following virus-specific types of RNA: (i) single-stranded RNA with a heterogeneous sedimentation pattern, the 38S viral RNA becoming the predominant species only after long periods of labeling late after infection; (ii) double-stranded RNA with a sedimentation coefficient of 20S; (iii) RNA apparently composed of 20S double-stranded RNA and single-stranded branches. On the basis of their properties, the last two species were tentatively identified as the replicative form and the replicative intermediate of rubella virus RNA. Rubella virus RNA was infectious.     

Location and role of free cysteinyl residues in the Sindbis virus E1 and E2 glycoproteins

Sindbis virus is a single-stranded positive-sense RNA virus. It is composed of 240 copies of three structural proteins: E1, E2, and capsid. These proteins form a mature virus particle composed of two nested T=4 icosahedral shells. A complex network of disulfide bonds in the E1 and E2 glycoproteins is developed through a series of structural intermediates as virus maturation occurs (M. Mulvey and D. T. Brown, J. Virol. 68:805-812, 1994; M. Carleton et al., J. Virol. 71:1558-1566, 1997). To better understand the nature of this disulfide network, E1 and E2 cysteinyl residues were labeled with iodoacetamide in the native virus particle and analyzed by liquid chromatography-tandem mass spectrometry. This analysis identified cysteinyl residues of E1 and E2, which were found to be label accessible in the native virus particle, as well as those that were either label inaccessible or blocked by their involvement in disulfide bonds. Native virus particles alkylated with iodoacetamide demonstrated a 4-log decrease in viral infectivity. This suggests that the modification of free cysteinyl residues results in the loss of infectivity by destabilizing the virus particle or that a rearrangement of disulfide bonds, which is required for infectivity, is blocked by the modification. Although modification of these residues prevented infectivity, it did not alter the ability of virus to fuse cells after exposure to acidic pH; thus, modification of free cysteinyl residues biochemically separated the process of infection from the process of membrane fusion.     

Synthesis of Saint Louis Encephalitis Virus Ribonucleic Acid in BHK-21/13 Cells

Infection of baby hamster kidney cells (BHK-21/13) with Saint Louis encephalitis (SLE) virus depressed the rate of protein and ribonucleic acid (RNA) synthesis until viral RNA synthesis began 6 hr postinfection (PI). Virus-directed RNA synthesis was subsequently inhibited until 12 hr PI when virion maturation began. The rate of protein synthesis reached a peak 6 hr PI and was subsequently depressed until just before the onset of virion maturation. Density gradient analysis of phenol-extracted RNA from actinomycin-treated infected cells indicated that, at 6 to 8 hr and again at 12 to 20 hr PI, three species of viral-specific RNA were synthesized. The most rapid sedimenting form (43S) was ribonuclease-sensitive and had a base composition similar to the RNA isolated from mature virions. The 20S RNA species was ribonuclease-resistant and had a sedimentation coefficient and base composition similar to the replicative form associated with other arbovirus infections. The 26S RNA was ribonuclease-resistant (0.2 mug/ml, 0.1 m NaCl, 25 C, 30 min) and had a nucleotide base composition closer to the 20S form than to the values for 43S RNA. Five-minute pulse labeling of infected cultures during the period viral RNA synthesis was maximal resulted in labeling of only the 20S to 22S RNA fractions. With pulse-labeling periods of 10 min, both the 20S and 26S RNA species were radioactive. Periods of radioactive labeling of as long as 15 min were required before the 43S form was radioactively labeled. These results suggest that the 20S and 26S RNA may be intermediate forms in the synthesis of 43S viral RNA.     

Temporal and Quantitative Expression of the Myelin-Associated Lipids,Ethanolamine Plasmalogen,Galactocerebroside, and Sulfatide,in the Differentiating CG-4 Glial Cell Line

We determined the expression of three myelin-typical lipids in the continuous CG-4 glial cell line of oligodendrocyte progenitor cells, as the cells differentiated into oligodendrocytes. On 6 different days during the first 9 days of oligodendrocyte development, cells were labeled for 24 h with [³H]ethanolamine to label ethanolamine plasmalogens or with [³H]galactose to label the galactocerebroside and sulfogalactocerebroside; and the amount of labeled lipid expressed on each day was determined. Each labeled lipid was expressed with its own specific time course and in a defined amount on each day of differentiation. Increased labeling of plasmalogens and sulfogalactocerebroside started at early developmental stages, and increased labeling of galactocerebroside started at later stages. The results indicate that the differentiating CG-4 cell line provides a valuable system to investigate factors affecting the early time course of myelin-lipid expression and the amounts expressed.     

Cytoplasmic Fractions Associated with Semliki Forest Virus Ribonucleic Acid Replication

When actinomycin D-treated chick fibroblasts were labeled with (3)H-uridine for varying periods during the log phase of Semliki Forest virus infection, radioactivity was found associated with different cytoplasmic fractions. After a 1-min period of labeling, it appeared in a large cytoplasmic structure which was seen in electron micrographs of infected cells. Sediments of sucrose density gradients of cytoplasmic extracts of these cells also contained these structures. Three forms of viral ribonucleic acid (RNA) were associated with this cytoplasmic structure: a ribonuclease-sensitive 42S form identical to the RNA of the mature virus, a ribonuclease-sensitive 26S form, and a ribonuclease-resistant 20S form. After a 5- to 10-min labeling period, radioactivity was associated with a ribonuclease-sensitive 65S cytoplasmic fraction which contained only the 26S RNA form. Finally, after a 1-hr labeling period, a 140S ribonuclease-resistant particle was the most prominent radioactive structure in the cytoplasm. This particle contained only 42S viral RNA. Negative-contrast electron micrographs of the 140S particle and the virion demonstrated structural differences between them. The base compositions of the 42S and 26S viral RNA forms were not significantly different. The base composition of the 20S form differed significantly from that of the other two viral RNA forms, but the values obtained for the mole fractions of the bases present in the 20S form differed, and depended on the period during the virus growth cycle in which (32)P was present. These results suggested that viral RNA originated in the large cytoplasmic body. The 20S RNA appeared to be a structure engaged in viral RNA replication and the 140S particle appeared to be a virus precursor.     

Effects of leaf nitrogen availability and leaf position on nitrogen allocation patterns in Vaccinium vitis-idaea and Vaccinium uliginosum

Summary Nitrogen allocation patterns from leaves of Vaccinium vitis-idaea (evergreen) and Vaccinium uliginosum (deciduous) were assessed using a foliar application of ¹⁵N labeled ammonium sulfate. These are wild perennial shrubs inhabiting arctic and subarctic regions. More label was transported from labeled leaves of Vaccinium uliginosum then Vaccinium vitis-idaea. In Vaccinium uliginosum, the amount of label transported from the labeled leaf increased as the concentration of nitrogen in the label increased. Current growth in Vaccinium uliginosum was a strong sink for nitrogen because most of the ¹⁵N transported from the labeled leaf was contained in this region. In addition, when greater quantities of nitrogen were applied, larger quantities were retained in current growth. Current growth of Vaccinium vitis-idaea, on the other hand, was not as strong a sink because regardless of the nitrogen available thru various label concentrations, the enrichment of current growth was not affected and was not significantly different from older stems or leaves. Yet, in both species, nitrogen was transported freely from leaves of all positions along the stem to all parts of the plant including roots and rhizomes. The position of the leaf along the stem had no effect on the patterns of allocation to other organs.