A comparison between inosine- and guanosine-containing anticodons in ribosome-free codon-anticodon binding

Binding of the ribooligomers, AUC, AUU, AUA, AUCA, AUUA, and AUAA to the isoleucine-accepting tRNAs, tRNA${}_{\mathrm{<mtext>T.\; utilis</mtext>}}{}^{\mathrm{Ile}}$ (anticodon, -IAU-) and tRNA${}_{\mathrm{<mtext>E.\; coli</mtext>}}{}^{\mathrm{Ile}}$ (anticodon, -GAU-) was measured by equilibrium dialysis. With the aid of Scatchard plots, AUCA was shown to bind to one site per tRNA molecule, presumably the anticodon. AUA and AUAA did not measurably attach to either anticodon in the ribosome-free system. All other oligomers were bound to tRNA${}_{\mathrm{<mtext>E.\; coli</mtext>}}{}^{\mathrm{Ile}}$ about 5 to 13 times stronger than to tRNA${}_{\mathrm{<mtext>T.\; utilis</mtext>}}{}^{\mathrm{Ile}}$.     

Anomalies in 5'-end [32P] labelling of transfer RNA and partial sequence of a tRNAGlu from Scenedesmus obliquus

A chloroplast tRNA_m^Met species from $\text{Scenedesmus}\text{obliquus}$ is very poorly 5′-end [${}^{32}\text{P}$] labelled using [γ-³²P]ATP and T4 polynucleotide kinase. In sequencing the tRNA using standard 5′-labelled methods a very minor contaminating tRNA is preferentially labelled. The partial tRNA sequence determined by this method has an anticodon (CUC) for tRNA^Glu.     

A general method for the direct isolation of the 3'-terminal fragments derived from transfer RNA molecules

A general procedure for the isolation of 3′-linked fragments derived from tRNA molecules is described. Purified N-2-naphthoxyacetylglycyl derivatives of the $\text{tRNA}{}_1{}^{\mathrm{Gly}}$ and $\text{tRNA}{}_2{}^{\mathrm{Gly}}$ of yeast were exhaustively digested with RNase T₁ and the 3′-linked fragments (bearing the derivative) were separated from other degradation products (lacking the derivative) by stepwise chromatography on BD-cellulose. Subsequent chromatographic resolution and base-composition analysis allowed tentative identification of the 3′-terminals of $\text{tRNA}{}_1{}^{\mathrm{Gly}}$ and $\text{tRNA}{}_2{}^{\mathrm{Gly}}$ as Gp(Cp,Ap)CpCpA and Gp(Cp,Cp,Up,Ap)CpCpA, respectively. The potential utility of this procedure for development of a novel approach to nucleic acid sequence analysis is discussed.     

On the mechanism of the reaction of tris(hydroxymethyl)aminomethane with activated carbonyl compounds: A model for the serine proteinases

The pH dependence of the reaction of tris(hydroxymethyl)aminomethane (Tris) with the activated carbonyl compound 4-trans-benzylidene-2-phenyloxazolin-5-one (I) is given by the equation $\text{k′}{}_2\text{=}\text{k}{}_{\mathrm{<mtext>b</mtext>}}\text{K}{}_{\mathrm{<mtext>a</mtext>}}\text{(K}{}_{\mathrm{<mtext>a</mtext>}}\text{+ [}\text{H}{}^{\mathrm{+}}\text{])}\text{+}\text{k}{}_{\mathrm{<mtext>a</mtext>}}\text{[}\text{OH}{}^{\mathrm{?}}\text{]K}{}_{\mathrm{<mtext>a</mtext>}}\text{(K}{}_{\mathrm{<mtext>a</mtext>}}\text{+ [}\text{H}{}^{\mathrm{+}}\text{])}$, where K_a is the dissociation constant of TrisH⁺. Spectrophotometric experiments show that the Tris ester of α-benzamido-trans-cinnamic acid is formed quantitatively over a range of pH values, regardless of the relative contribution of k_b and k_a terms to k′₂. Hence, both terms refer to alcoholysis. While the mechanism of the reaction is not determined unequivocally in the present work, the magnitude of the k_b term, together with its dependence on the basic form of Tris, suggests that ester formation is occurring by nucleophilic attack of a Tris hydroxyl group on the carbonyl carbon of the oxazolinone, with intramolecular catalysis by the Tris amino group. The rate enhancement due to this group is at least 10² and possibly of the order 10⁶. This system is compared with other model systems for the acylation step of catalysis by serine esterases and proteinases.     

New experimental approach to the estimation of rate of electron transfer from the primary to secondary acceptors in the photosynthetic electron transport chain of purple bacteria

A method for calculating the rate constant ($\text{K}{}_{\mathrm{<mtext>A</mtext><mtext>1</mtext><mtext>A</mtext><mtext>2</mtext>}}$) for the oxidation of the primary electron acceptor (A₁) by the secondary one (A₂) in the photosynthetic electron transport chain of purple bacteria is proposed.The method is based on the analysis of the dark recovery kinetics of reaction centre bacteriochlorophyll (P) following its oxidation by a short single laser pulse at a high oxidation-reduction potential of the medium. It is shown that in Ectothiorhodospira shaposhnikovii there is little difference in the value of $\text{K}{}_{\mathrm{<mtext>A</mtext><mtext>1</mtext><mtext>A</mtext><mtext>2</mtext>}}$ obtained by this method from that measured by the method of Parson ((1969) Biochim. Biophys. Acta 189, 384–396), namely: $\text{(4.5±1.4) · 10}{}^3\text{s}{}^{\mathrm{?1}}$ and $\text{(6.9±1.2) · 10}{}^3\text{s}{}^{\mathrm{?1}}$, respectively.The proposed method has also been used for the estimation of the $\text{K}{}_{\mathrm{<mtext>A</mtext><mtext>1</mtext><mtext>A</mtext><mtext>2</mtext>}}$ value in chromatophores of Rhodospirillum rubrum deprived of constitutive electron donors which are capable of reducing P⁺ at a rate exceeding this for the transfer of electron from A₁ to A₂. The method of Parson cannot be used in this case. The value of $\text{K}{}_{\mathrm{<mtext>A</mtext><mtext>1</mtext><mtext>A</mtext><mtext>2</mtext>}}$ has been found to be $\text{(2.7±0.8) · 10}{}^3\text{s}{}^{\mathrm{?1}}$.The activation energies for the A₁ to A₂ electron transfer have also been determined. They are 12.4 kcal/mol and 9.9 kcal/mol for E. shaposhnikovii and R. rubrum, respectively.     

Calcium induction of transglutaminase and the formation of epsilon(gamma-glutamyl) lysine cross-links in cultured mouse epidermal cells

A lysine tRNA (anticodon U¹UU) was isolated from rat liver mitochondria and sequenced. The sequence, pCAUUGCGAm¹Am²GCUUAGAGCm²GUUAACCU$\text{U}{}^1\text{UU}$-t⁶AAGUUAAAGUUAGAGACAACAAAUCUCCACAAUGACCA_OH, can be written in cloverleaf form. It exhibits many unorthodox features, perhaps the most strikking of which is the small size of the D-arm consisting of only 9 nucleotides. The anticodon loop contains 2 hypermodified nucleotides, U¹27 (probably 5-methoxycarbonylmethyluridine) and t⁶A30 (N-[N-(9-β-D-ribofuranosylpurin-6-yl)carbamoyl]threonine). The presence of U¹ in the first (“wobble”) position of the anticodon probably prevents the lysine tRNA from reading asparagine (AAY) codons. t⁶A, which is 3′-adjacent to the anticodon in most tRNAs recognizing codons starting with A, and other modified nucleosides occupy expected positions. We hypothesize that enzymes modifying the wobble position and the position 3′-adjacent to the anticodon recognize specific nucleotides in the anticodon.     

Catalytic properties of the resolved flavoprotein and cytochrome B components of the NADPH dependent O2−• generating oxidase from human neutrophils

The resolved flavoprotein and cytochrome b₅₅₉ components of the NADPH dependent $\text{O}{}_2{}^{\mathrm{?}}{}_{\mathrm{?}}$ generating oxidase from human neutrophils were the subject of further study. The resolved flavoprotein, depleted of cytochrome b₅₅₉, was reduced by NADPH under anaerobic conditions and reoxidized by oxygen. NADPH dependent $\text{O}{}_2{}^{\mathrm{?}}{}_{\mathrm{?}}$ generation by the resolved flavoprotein fraction was not detectable, however it was competent in the transfer of electrons from NADPH to artificial electron acceptors. The resolved cytochrome b₅₅₉, depleted of flavoprotein, demonstrated no measureable NADPH dependent $\text{O}{}_2{}^{\mathrm{?}}{}_{\mathrm{?}}$ generating activity and was not reduced by NADPH under anaerobic conditions. The dithionite reduced form of the resolved cytochrome b₅₅₉ was rapidly oxidized by oxygen, as was the cytochrome b₅₅₉ in the intact oxidase.     

Modifications of redox equilibria with semiquinone stabilization upon pyruvate binding to L-lactate cytochrome c oxidoreductase (flavocytochrome b2)

Spectral redox titrations of flavin and cytochrome b₂ moieties of flavocytochrome b₂ were achieved in the absence and in the presence of pyruvate under equilibrium conditions at 18° C; direct measurements of spin flavosemiquinone proportions have been carried out by EPR determinations at the same temperature. Our results show that the equilibria involving flavin are largely affected by the presence of pyruvate; the semiquinone proportion markedly increases almost till unit near half-reduction of cytochrome b₂; at 10 mM pyruvate, the dismutation constant, $\text{K}{}_{\mathrm{dism}}\text{=}\text{(}\text{F}{}_{\mathrm{s}}\text{)}{}^2\text{(}\text{F}{}_{\mathrm{o}}\text{)}{}^1\text{(}\text{F}{}_{\mathrm{r}}\text{)}$ increases by a factor ≥ 10.     

The effect of formate on cytochrome aa3 and on electron transport in the intact respiratory chain

1. Formate inhibits cytochrome $\text{c}$ oxidase activity both in intact mitochondria and submitochondrial particles, and in isolated cytochrome $\text{aa}{}_3$. The inhibition increases with decreasing pH, indicating that HCOOH may be the inhibitory species.2. Formate induces a blue shift in the absorption spectrum of oxidized cytochrome $\text{aa}{}_3\text{(a}{}^{\mathrm{3+}}\text{a}{}_3{}^{\mathrm{3+}}$) and in the half-reduced species ($\text{a}{}^{\mathrm{2+}}\text{a}{}_3{}^{\mathrm{3+}}$). Comparison with cyanide-induced spectral shifts, towards the red, indicates that formate and cyanide have opposite effects on the $\text{aa}{}_3$ spectrum, both in the fully oxidized and the half-reduced states. The formate spectra provide a new method of obtaining the difference spectrum of $\text{a}{}_3{}^{\mathrm{2+}}$ minus $\text{a}{}_3{}^{\mathrm{3+}}$, free of the difficulties with cyanide (which induces marked high → low spin spectral shifts in cytochrome $\text{a}{}_3{}^{\mathrm{3+}}$) and azide (which induces peak shifts of cytochrome $\text{a}{}^{\mathrm{2+}}$ towards the blue in both α- and Soret regions).3. The rate of formate dissociation from cytochrome $\text{a}{}^{\mathrm{2+}}\text{a}{}_3{}^{\mathrm{3+}}\text{-}\text{HCOOH}$ is faster than its rate of dissociation from $\text{a}{}^{\mathrm{3+}}\text{a}{}_3{}^{\mathrm{3+}}\text{-}\text{HCOOH}$, especially in the presence of cytochrome $\text{c}$. The $\text{K}{}_{\mathrm{<mtext>i</mtext>}}$ for formate inhibition of respiration is a function of the reduction state of the system, varying from 30 mM (100% reduction) to 1 mM (100% oxidation) at pH 7.4, 30 °C.4. Succinate-cytochrome $\text{c}$ reductase activity is also inhibited by formate, in a reaction competitive with succinate and dependent on [formate]².5. Formate inhibition of ascorbate plus $\text{N,N,N′,N′-}\text{tetramethyl}\text{-p-}\text{phenyl-enediamine}$ oxidation by intact rat liver mitochondria is partially released by uncoupler addition. Formate is permeable through the inner mitochondrial membrane and no differences in ‘on’ or ‘off’ inhibition rates were observed when intact mitochondria were compared with submitochondrial particles.6. NADH-cytochrome $\text{c}$ reductase activity is unaffected by formate in submitochondrial particles, but mitochondrial oxidation of glutamate plus malate is subject both to terminal inhibition at the cytochrome $\text{aa}{}_3$ level and to a slow extra inhibition by formate following uncoupler addition, indicating a third site of formate action in the intact mitochondrion.     

Equilibrium constants for association of guanidinium and ammonium ions with oxyanions: The effect of changing basicity of the oxyanion

Using guanidinium and n-butylammonium cations (C⁺) as models for the positively charged side chains in arginine and lysine, we have determined the association constants with various oxyanions by potentiometric titration. For a dibasic acid, H₂A, three association complexes may exist: $\text{K}{}_{\mathrm{<mtext>1M</mtext>}}\text{=}\text{[CHA]}\text{[C}{}^{\mathrm{+}}\text{]}\text{[HA}{}^{\mathrm{?}}\text{]}$; $\text{K}{}_{\mathrm{<mtext>1D</mtext>}}\text{=}\text{[CA}{}^{\mathrm{?}}\text{]}\text{[C}{}^{\mathrm{+}}\text{]}\text{[A}{}^{\mathrm{2?}}\text{]}$; $\text{K}{}_{\mathrm{<mtext>2D</mtext>}}\text{=}\text{[C}{}_2\text{A]}\text{[C}{}^{\mathrm{+}}\text{]}\text{[CA}{}^{\mathrm{?}}\text{]}$. For guanidinium ion and phosphate, K_1M = 1.4, K_1D = 2.6, and K_2D = 5.1. The data for carboxylates indicate that the basicity of the oxyanion does not affect the association constant: acetate, pK_a = 4.8, K_1M = 0.37; formate, pK_a = 3.8, K_1M = 0.32; and chloroacetate, pK_a = 2.9, K_1M = 0.43, all with guanidinium ion. Association constants are also reported for carbonate, dimethylphosphinate, benzylphosphonate, and adenylate anions.     

Kinetics of bidirectional active sodium fluxes in the toad bladder

The kinetics of isotopic Na⁺ flows was studied in urinary bladders of toads from the Dominican Republic. Initial studies of the potential dependence of passive serosal to mucosal ²²Na⁺ efflux demonstrated the absence of isotope interaction and/or other coupling with passive Na⁺ flow. The electrical current $\text{I}$ and mucosal to serosal ²²Na⁺ influx were then measured with transmembrane potential clamped at $\text{Δψ = 0, 25, 50, 75 or 100}\text{mV}$. Subsequent elimination of active Na⁺ transport mucosal amiloride permitted calculation of the rates of active Na⁺ transport $\text{J}{}_{\mathrm{<mtext>Na</mtext>}}{}^{\mathrm{<mtext>a</mtext>}}$ and active and passive influx and $\text{J}{}_{\mathrm{<mtext>Na</mtext>}}{}^{\mathrm{<mtext>a</mtext>}}$ and $\text{J}{}_{\mathrm{<mtext>Na</mtext>}}{}^{\mathrm{<mtext>p</mtext>}}$. The results indicate that for Dominican toad bladders mounted in chambers only Na⁺ contributes significantly to transepithelial active ion transport; hence $\text{J}{}_{\mathrm{<mtext>Na</mtext>}}{}^{\mathrm{<mtext>a</mtext>}}\text{= J}{}^{\mathrm{<mtext>a</mtext>}}$. $\text{J}{}^{\mathrm{<mtext>a</mtext>}}$ was abolished at $\text{Δψ = E = 96.3 ± 1.9}\text{(S.E.) mV}$. As Δψ approached $\text{E}$, active efflux $\text{J}{}^{\mathrm{<mtext>a</mtext>}}$ became demonstrable. At $\text{Δ = 100}\text{mV}\text{,}\text{J}{}^{\mathrm{<mtext>a</mtext>}}$ exceeded $\text{J}{}^{\mathrm{<mtext>a</mtext>}}$, so that $\text{J}{}^{\mathrm{<mtext>a</mtext>}}$ was negative. Experimental values of $\text{J}{}^{\mathrm{<mtext>a</mtext>}}$ agreed well with theoretical values predicted by a thermodynamic formulation: $\text{J}{}_{\mathrm{<mtext>exp</mtext>}}{}^{\mathrm{<mtext>a</mtext>}}\text{= 0.985}\text{J}{}_{\mathrm{<mtext>theor</mtext>}}{}^{\mathrm{<mtext>a</mtext>}}\text{(r = 0.993)}$. The dependence of $\text{J}{}^{\mathrm{<mtext>a</mtext>}}$ on Δψ is curvilinear.     

Effects of 5-hydroxylysine on acetylene reduction and NH4+-assimilation in the cyanobacterium Anabaena cylindrica.

5-hydroxylysine, an analogue of glutamate and lysine, causes $\text{NH}{}_4{}^{\mathrm{+}}$ production by N₂-fixing A. cylindrica; it also reversibly inhibits GS activity in vitro but has no effect on alanine dehydrogenase or GOGAT. On adding 5-hydroxylysine intracellular pools of glutamine, glutamate and aspartate decrease; those of alanine and serine increase. 5-hydroxylysine alleviates the inhibitory effect of $\text{NH}{}_4{}^{\mathrm{+}}$ on heterocyst production and C₂H₂ reduction and in $\text{NH}{}_4{}^{\mathrm{+}}\text{-grown}$ cultures results in heterocyst synthesis and in C₂H₂ reduction. The data suggest that the GS-GOGAT pathway is the sole route of importance in primary $\text{NH}{}_4{}^{\mathrm{+}}$ assimilation in A. cylindrica, that $\text{NH}{}_4{}^{\mathrm{+}}$ alone does not inhibit nitrogenase and heterocyst production, and that GS and/or a product is involved in regulating the production of both.     

Influence of ionic strength upon the proton inventory for the water-catalyzed hydrolysis of N-acetylbenzotriazole

Proton inventory investigations of the hydrolysis N-acetylbenzotriazole at pH 3.0 (or the equivalent point on the pD rate profile) have been conducted at two different temperatures and at ionic strengths ranging from 0 to 3.0 M. The solvent deuterium isotope effects and proton inventories are remarkably similar over this wide range of conditions. The proton inventories suggest a cyclic transition state involving four protons contributing to the solvent deuterium isotope effect for the water-catalyzed hydrolysis. The hydrolysis data are described by the equation $\text{k}{}_{\mathrm{n}}\text{= k}{}_{\mathrm{<mtext>o</mtext>}}\text{(1 ? n + nπ}{}_{\mathrm{<mtext>a</mtext>}}{}^1\text{)}{}^4$ with $\text{π}{}_{\mathrm{<mtext>a</mtext>}}{}^1\text{～ 0.74}$, where k_o is the observed first-order rate constant in protium oxide, n is the atom fraction of deuterium in the solvent, k_n is the rate constant in a protium oxide-deuterium oxide mixture, and $\text{π}{}_{\mathrm{<mtext>a</mtext>}}{}^1$ is the isotopic fractionation factor.     

Single-electron transfer from NADH analogues to singlet oxygen

Laser flash photolysis techniques have yielded rate constants for physical and reactive quenching modes of $\text{O}{}_2\text{(}{}^1\text{Δ}{}_{\mathrm{<mtext>g</mtext>}}\text{)}$ by nicotine, nicotinamide adenine dinucleotide (oxidized and reduced forms) and the reduced forms of nicotinamide mononucleotide, nicotinamide adenine dinucleotide phosphate and nicotinamide hypoxanthine dinucleotide. In the case of the last four named compounds, kinetic spectroscopy furnished evidence for one-electron transfers to $\text{O}{}_2\text{(}{}^1\text{Δ}{}_{\mathrm{<mtext>g</mtext>}}\text{)}$. Specifically, production of O^?₂ was demonstrated unequivocally by reaction with 1,4-benzoquinone. Quantitative determinations revealed the extent of reactive quenching to be near 60% in each case.     

Acid dissociation of cyclohexaamylose and cycloheptaamylose

Acid dissociation constants of aqueous cyclohexaamylose (6-Cy) and cycloheptaamylose (7-Cy) have been determined at 10–47 and 25–55°C, respectively, by pH potentiometry. Standard enthalpies and entropies of dissociation derived from the temperature dependences of these pK_a's are ΔH⁰ = 8.4 ± 0.3 kcal mol^?1, $\text{Δ}\text{S}{}^0\text{= ?28. ± 1}\text{cal mol}{}^{\mathrm{?1}}{}^0\text{K}{}^{\mathrm{?1}}$ for 6-Cy and ΔH⁰ = 10.0 ± 0.1 kcal mol^?1, $\text{Δ}\text{S}{}^0\text{= ?22.4 ±0.3}\text{cal mol}{}^{\mathrm{?1}}{}^0\text{K}{}^{\mathrm{?1}}$ for 7-Cy. Intrinsic ¹³C nmr resonance displacements of anionic 6- and 7-Cy were measured at 30°C in 5% D₂O ($\text{v}\text{v}$). These results indicate that the dissociation of 6- and 7-Cy involves both C2 and C3 2⁰-hydroxyl groups. The thermodynamic and nmr parameters are discussed in terms of interglucosyl hydrogen bonding.     

The one-electron transfer redox potentials of free radicals. I. The oxygen/superoxide system

The method of determination of Redox potentials of radicals, using the pulse radiolysis technique, is outlined. The method is based on the determination of equilibrium constants of electron transfer reactions between the radicals and appropriate acceptors. The limitations of this technique are discussed.The redox potentials of several quinones-semiquinones are calculated, as well as the standard redox potential of the peroxy radical. and the redox oxidation properties of the peroxy radical in various systems and pH are discussed. The value determined for the redox potentials of $\text{O}{}_2\text{O}{}_2{}^{\mathrm{?}}$ is higher by more than 0.2 V than earlier estimates, which has important implications on the possible role of O₂^? in biological processes of O₂ fixation.     

Esterification of chlorophyllide by geranylgeranyl pyrophosphate in a cell-free system from maize shoots.

A cell-free system is described which incorporates [${}^{14}\text{C}$]-geranylgeranyl pyrophosphate, but not free [${}^{14}\text{C}$]-geranylgeraniol, into chlorophyll a_{geranylgeraniol}. The esterifying enzyme is found in the 75,000 g pellet of a homogenate from maize shoots whereas most of the phosphatase activity remains in the supernatant. The enzyme is different from chlorophyllase which has been discussed in the literature as the possible esterifying enzyme.     

Respiration-driven proton translocation with nitrite and nitrous oxide in Paracoccus denitrificans

(1) $\text{H}$⁺/electron acceptor ratios have been determined with the oxidant pulse method for cells of denitrifying Paracoccus denitrificans oxidizing endogenous substrates during reduction of O₂, NO^?₂ or N₂O. Under optimal H⁺-translocation conditions, the ratios $\text{H}{}^{\mathrm{+}}\text{O}$, $\text{H}{}^{\mathrm{+}}\text{N}{}_2\text{O}$, $\text{H}{}^{\mathrm{+}}\text{NO}{}^{\mathrm{?}}{}_2$ for reduction to N₂ and $\text{H}{}^{\mathrm{+}}\text{NO}{}^{\mathrm{?}}{}_2$ for reduction to N₂O were 6.0–6.3, 4.02, 5.79 and 3.37, respectively. (2) With ascorbate/N,N,N′,N′-tetramethyl-p-phenylenediamine as exogenous substrate, addition of NO^?₂ or N₂O to an anaerobic cell suspension resulted in rapid alkalinization of the outer bulk medium. $\text{H}{}^{\mathrm{+}}\text{N}{}_2\text{O}$, $\text{H}{}^{\mathrm{+}}\text{NO}{}^{\mathrm{?}}{}_2$ for reduction to N₂ and $\text{H}{}^{\mathrm{+}}\text{NO}{}^{\mathrm{?}}{}_2$ for reduction to N₂O were ?0.84, ?2.33 and ?1.90, respectively. (3) The $\text{H}{}^{\mathrm{+}}\text{oxidant}$ ratios, mentioned in item 2, were not altered in the presence of $\text{valinomycin}\text{K}{}^{\mathrm{+}}$ and the triphenylmethylphosphonium cation. (4) A simplified scheme of electron transport to O₂, NO^?₂ and N₂O is presented which shows a periplasmic orientation of the nitrite reductase as well as the nitrous oxide reductase. Electrons destined for NO^?₂, N₂O or O₂ pass two H⁺-translocating sites. The $\text{H}{}^{\mathrm{+}}\text{electron}$ acceptor ratios predicted by this scheme are in good agreement with the experimental values.     

Chlorophyllide b

Chlorophylls a,b and chlorophyllides a,b were isolated from pea chloroplasts as pheophorbides a,b following the administration of $\text{[}{}^{14}\text{C]δ-aminolevulinic}$ acid. Relative pool sizes suggest that chlorophyllide b precedes chlorophyll b and does not arise from the latter by the action of chlorophyllase.