共查询到20条相似文献,搜索用时 694 毫秒
1.
We investigated the virulence of three 2009 west Alabama isolates of Aeromonas hydrophila (AL09-71, AL09-72 and AL09-73) to channel catfish Ictalurus punctatus fingerlings (4.6 +/- 1.3 g) in the presence and absence of extracellular products (ECPs) from overnight bacterial culture using both bath immersion and intraperitoneal injection routes. At a concentration of 1.65 x 10(8) colony-forming units (CFU) ml(-1), AL09-73 without its ECPs killed 100% of the catfish fingerlings within 2 h by bath immersion. However, at a similar concentration, AL09-73 in the presence of its ECPs killed only 23 +/- 6% catfish fingerlings. The absence of ECPs in the bath immersion experiment also significantly (p < 0.05) increased the virulence of AL09-71, AL09-72, and AL98-C1B, a 1998 Alabama strain of A. hydrophila, suggesting that the virulence of the 4 A. hydrophila isolates was mainly due to bacterial cells, not to their overnight ECPs. Filter-sterilized ECPs failed to kill any catfish by bath immersion or injection. The virulence order of the 4 A. hydrophila isolates, by both bath immersion and intraperitoneal injection, was: AL09-73 > or = AL09-71 > AL09-72 > or = AL98-C1B. At 2 h post bath immersion, all 4 isolates of A. hydrophila were found in all tissues studied (skin, intestine, liver, spleen, kidney, gill and brain), with the highest bacteria count being in the gill and kidney. 相似文献
2.
Wenlong Cai Leonardo De La Fuente Covadonga R. Arias 《Applied and environmental microbiology》2013,79(18):5633-5642
Flavobacterium columnare is a bacterial fish pathogen that affects many freshwater species worldwide. The natural reservoir of this pathogen is unknown, but its resilience in closed aquaculture systems posits biofilm as the source of contagion for farmed fish. The objectives of this study were (i) to characterize the dynamics of biofilm formation and morphology under static and flow conditions and (ii) to evaluate the effects of temperature, pH, salinity, hardness, and carbohydrates on biofilm formation. Nineteen F. columnare strains, including representatives of all of the defined genetic groups (genomovars), were compared in this study. The structure of biofilm was characterized by light microscopy, confocal laser scanning microscopy, and scanning electron microscopy. F. columnare was able to attach to and colonize inert surfaces by producing biofilm. Surface colonization started within 6 h postinoculation, and microcolonies were observed within 24 h. Extracellular polysaccharide substances and water channels were observed in mature biofilms (24 to 48 h). A similar time course was observed when F. columnare formed biofilm in microfluidic chambers under flow conditions. The virulence potential of biofilm was confirmed by cutaneous inoculation of channel catfish fingerlings with mature biofilm. Several physicochemical parameters modulate attachment to surfaces, with the largest influence being exerted by hardness, salinity, and the presence of mannose. Maintenance of hardness and salinity values within certain ranges could prevent biofilm formation by F. columnare in aquaculture systems. 相似文献
3.
Flavobacterium columnare is an aquatic bacterium that is responsible for columnaris disease. This aquatic pathogen has a worldwide distribution and is highly infectious to both warm and cold water fish. A modified live F. columnare vaccine was developed by repeated passage of a virulent strain on increasing concentrations of rifampicin that resulted in attenuation. Here we report vaccination/challenge trials to evaluate efficacy and safety. In separate laboratory trials, immersion vaccination of channel catfish (Ictalurus punctatus) fry between 10 to 48 days post hatch (DPH) with experimental vaccine or licensed product resulted in relative percent survival (RPS) between 57–94% following challenge. Similarly, a vaccination/challenge trial using largemouth bass (Micropterus salmoides) fry at 10 DPH was performed using various doses of licensed product under laboratory conditions. Results demonstrated safety of the vaccine and significant protection following challenge with RPS values between 74–94%, depending on vaccine dose. Together, these trials demonstrate the vaccine administered to early life-stage channel catfish and largemouth bass is safe and reduces mortality following challenge with F. columnare. 相似文献
4.
Background
Flavobacterium columnare causes columnaris disease in cultured and wild fish populations worldwide. Columnaris is the second most prevalent bacterial disease of commercial channel catfish industry in the United States. Despite its economic importance, little is known about the expressed proteins and virulence mechanisms of F. columnare. Here, we report the first high throughput proteomic analysis of F. columnare using 2-D LC ESI MS/MS and 2-DE MALDI TOF/TOF MS. 相似文献5.
Tejedor JL Vela AI Gibello A Casamayor A Domínguez L Fernández-Garayzábal JF 《Letters in applied microbiology》2011,53(6):614-619
Aims: Genetic comparison of Lactococcus garvieae isolated from mammals and fish. Methods and Results: One hundred and ninety‐seven L. garvieae isolates obtained from trout (n = 153), cow (n = 7) and pigs (n = 37) were genetically characterized by determining their pulsed‐field gel electrophoresis (PFGE) profiles after macrorestriction with Bsp120I. Overall, L. garvieae isolates from pigs, cow and trout exhibited distinct PFGE patterns, with a low genetic relationship between them. Isolates from trout generated two pulsotypes [Genetic diversity (GD) 0·01] showing that the fish isolates were more genetically homogenous than the others. The L. garvieae isolates from cows displayed five (GD 0·71) different pulsotypes, while the swine isolates displayed 13 different pulsotypes (GD 0·35). Twenty‐one of the 37 swine strains (56·8%) were grouped in a single cluster that included two closely related (93% similarity) pulsotypes. These pulsotypes exhibited a high frequency of isolation from different organs of the animals, and they were also broadly distributed among herds, suggesting a wide distribution across the swine population. This suggests that L. garvieae might be able to colonize different organs of the swine cardio‐respiratory system. Conclusions: Results indicate that most L. garvieae isolates from pigs and trout exhibited a distinct genetic background. Significance and Impact of the Study: The present study describes the isolation of L. garvieae from both diseased and healthy pigs for the first time, and the findings suggest that pigs could be a previously unknown reservoir of this pathogen. 相似文献
6.
In our on‐going pursuit to discover natural products and natural product‐based compounds to control the bacterial species Flavobacterium columnare, which causes columnaris disease in channel catfish (Ictalurus punctatus), we synthesized flavone and chalcone analogs, and evaluated these compounds, along with flavonoids from natural sources, for their antibacterial activities against two isolates of F. columnare (ALM‐00‐173 and BioMed) using a rapid bioassay. The flavonoids chrysin ( 1a ), 5,7‐dihydroxy‐4′‐methoxyflavone ( 11 ), isorhamnetin ( 26 ), luteolin ( 27 ), and biochanin A ( 29 ), and chalcone derivative 8b showed strong antibacterial activities against F. columnare ALM‐00‐173 based on minimum inhibition concentration (MIC) results. Flavonoids 1a, 8, 11, 13 (5,4′‐dihydroxy‐7‐methoxyflavone), 26 , and 29 exhibited strong antibacterial activities against F. columnare BioMed based upon MIC results. The 24‐h 50% inhibition concentration (IC50) results revealed that 27 and 29 were the most active compounds against F. columnare ALM‐00‐173 (IC50 of 7.5 and 8.5 mg/l, resp.), while 26 and 29 were the most toxic compound against F. columnare BioMed (IC50 of 9.2 and 3.5 mg/l, resp.). These IC50 results were lower than those obtained for wogonin against F. columnare ALM‐00‐173 and F. columnare BioMed (28.4 and 5.4 mg/l, resp.). However, based on MIC results, none of the compounds evaluated in this study were as active as wogonin (MIC 0.3 mg/l for each F. columnare isolate). Further modification of the wogonin structure to enhance antibacterial is of interest. 相似文献
7.
Anniina Runtuvuori-Salmela Heidi M. T. Kunttu Elina Laanto Gabriel M. F. Almeida Kati Mäkelä Mathias Middelboe Lotta-Riina Sundberg 《Environmental microbiology》2022,24(5):2404-2420
Intensive aquaculture conditions expose fish to bacterial infections, leading to significant financial losses, extensive antibiotic use and risk of antibiotic resistance in target bacteria. Flavobacterium columnare causes columnaris disease in aquaculture worldwide. To develop a bacteriophage-based control of columnaris disease, we isolated and characterized 126 F. columnare strains and 63 phages against F. columnare from Finland and Sweden in 2017. Bacterial isolates were virulent on rainbow trout (Oncorhynchus mykiss) and fell into four previously described genetic groups A, C, E and G, with genetic groups C and E being the most virulent. Phage host range studied against a collection of 227 bacterial isolates (from 2013 to 2017) demonstrated modular infection patterns based on host genetic group. Phages infected contemporary and previously isolated bacterial hosts, but bacteria isolated most recently were generally resistant to previously isolated phages. Despite large differences in geographical origin, isolation year or host range of the phages, whole-genome sequencing of 56 phages showed high level of genetic similarity to previously isolated F. columnare phages (Ficleduovirus, Myoviridae). Altogether, this phage collection demonstrates a potential for use in phage therapy. 相似文献
8.
Predator Avoidance of Transgenic Channel Catfish Containing Salmonid Growth Hormone Genes 总被引:6,自引:0,他引:6
Dunham RA Chitmanat C Nichols A Argue B Powers DA Chen TT 《Marine biotechnology (New York, N.Y.)》1999,1(6):545-551
Transgenic channel catfish (Ictalurus punctatus) containing salmonid growth hormone genes can grow 33% faster than normal channel catfish under aquaculture conditions. However,
before transgenic catfish are released and utilized by the private sector, their genetic impact on the natural environment
must be examined. Predator avoidance is one of the major fitness traits determining potential environmental risk. To determine
the predator avoidance ability and growth performance of transgenic catfish in a natural habitat, various densities of transgenic
and nontransgenic channel catfish were communally stocked in 0.04-ha earthen ponds without supplemental feeding. Largemouth
bass (Micropterus salmoides) and green sunfish (Lepomis cyanellus) were stocked as predators. Nontransgenic fry had better predator avoidance than transgenic channel catfish when data were
pooled (p < .01). When data were not pooled, nontransgenic catfish had better predator avoidance in six trials and transgenic individuals
had better predator avoidance in four trials. There was no difference in predator avoidance in three trials. Overall predator
avoidance was also better for nontransgenic individuals (p < .01) when the fish were evaluated as 3.5-g fingerlings, more clearly than as fry, as transgenic individuals were more vulnerable
in 3 of 4 trials at this life stage. There was no significant difference in growth performance between transgenic and nontransgenic
channel catfish in ponds without supplemental feeding. These findings indicate that transgenic channel catfish could be used
for commercial aquaculture without affecting the natural environment. Although transgenic channel catfish may be released
to nature by accident, any ecological effect would be unlikely because the increased susceptibility of transgenic channel
catfish to predators would most likely decrease or eliminate the transgenic genotype.
Received March 8, 1999; accepted June 3, 1999. 相似文献
9.
We present experimental data on susceptibility to columnaris disease, caused by the bacterium Flavobacterium columnare, in hybrid catfish (female channel catfish Ictalurus punctatus × male blue catfish I. furcatus) (C×B). Under our experimental conditions, C×B hybrids were significantly more resistant to columnaris disease caused by the highly virulent strain of F. columnare BGFS-27 (genomovar II) than channel catfish and blue catfish. Channel and blue catfish cumulative mortalities after immersion challenge were 74 and 87%, respectively, whereas mortality in the C×B hybrid was 31%. Susceptibility to the strain ARS-1 (genomovar I) was lower among all catfishes, although channel catfish was the least resistant species at 32% cumulative mortality. By contrast, C×B hybrid and blue catfishes were strongly resistant to the ARS-1 strain, with <10% mortality. Our data suggest enhanced disease resistance of the C×B hybrid to columnaris disease. 相似文献
10.
Rashmi Aggarwal Veer B. Singh Renu Shukla Malkhan Singh Gurjar Sangeeta Gupta Tilak R. Sharma 《Journal of Phytopathology》2010,158(4):210-216
Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. 相似文献
11.
K. Apun P.P. Chang E.U.H Sim V. Micky 《World journal of microbiology & biotechnology》2006,22(7):661-667
Summary
Escherichia coli, including Shiga-like toxin producing E. coli (STEC), serogroup O157:H7 and E. coli O157, were isolated from raw beef marketed in Sarawak and Sabah, East Malaysia. Molecular subtyping by pulsed-field gel electrophoresis
(PFGE) was performed on 51 confirmed E. coli isolates. Of the 51 isolates, five were E. coli O157:H7, four E. coli O157, two non-O157 STEC and 40 other E. coli isolates (non-STEC). Digestion of chromosomal DNA from these E. coli isolates with restriction endonuclease XbaI (5′-TCTAGA-3′), followed by PFGE, produced 45 restriction endonuclease digestion profiles (REDPs) of 10–18 bands. E. coli O157:H7 isolates from one beef sample were found to have identical PFGE profiles. In contrast, E. coli serogroup O157 from different beef samples displayed considerable differences in their PFGE profiles. These suggested that
E. coli isolates of both serogroups were not closely related. A large variety of PFGE patterns among non-STEC isolates were observed,
demonstrating a high clonal diversity of E. coli in the beef marketed in East Malaysia. The distance matrix values (D), calculated showed that none of the pathogenic E. coli strains displayed close genetic relationship with the non-STEC strains. Based on the PFGE profiles, a dendrogram was generated
and the isolates were grouped into five PFGE clusters (A–E). From the dendrogram, the most related isolates were E. coli O157:H7, grouped within cluster B. The STEC O157:H7 beef isolates were more closely related to the clinical E. coli O157:H7 isolate than the E. coli O157:H7 reference culture, EDL933. Cluster A, comprising many of other E. coli isolates was shown to be the most heterogeneous. PFGE was shown to possess high discriminatory power in typing pathogenic
and non-pathogenic E. coli strains, and useful in studying possible clonal relationship among strains. 相似文献
12.
Diversity of Proteolytic Clostridium botulinum Strains, Determined by a Pulsed-Field Gel Electrophoresis Approach 下载免费PDF全文
Mari Nevas Miia Lindstr?m Sebastian Hielm K. Johanna Bj?rkroth Michael W. Peck Hannu Korkeala 《Applied microbiology》2005,71(3):1311-1317
Pulsed-field gel electrophoresis (PFGE) was applied to the study of the similarity of 55 strains of proteolytic Clostridium botulinum (C. botulinum group I) types A, AB, B, and F. Rare-cutting restriction enzymes ApaI, AscI, MluI, NruI, PmeI, RsrII, SacII, SmaI, and XhoI were tested for their suitability for the cleavage of DNA of five proteolytic C. botulinum strains. Of these enzymes, SacII, followed by SmaI and XhoI, produced the most convenient number of fragments for genetic typing and were selected for analysis of the 55 strains. The proteolytic C. botulinum species was found to be heterogeneous. In the majority of cases, PFGE enabled discrimination between individual strains of proteolytic C. botulinum types A and B. The different toxin types were discriminated at an 86% similarity level with both SacII and SmaI and at an 83% similarity level with XhoI. Despite the high heterogeneity, three clusters at a 95% similarity level consisting of more than three strains of different origin were noted. The strains of types A and B showed higher diversity than the type F organisms which formed a single cluster. According to this survey, PFGE is to be considered a useful tool for molecular epidemiological analysis of proteolytic C. botulinum types A and B. However, epidemiological conclusions based on PFGE data only should be made with discretion, since highly similar PFGE patterns were noticed, especially within the type B strains. 相似文献
13.
《Systematic and applied microbiology》2022,45(2):126293
Flavobacterium columnare is the causative agent of columnaris disease in freshwater fish and four discrete genetic groups exist within the species, suggesting that the species designation requires revision. The present study determined the taxonomic status of the four genetic groups of F. columnare using polyphasic and phylogenomic approaches and included five representative isolates from each genetic group (including type strain ATCC 23463T; genetic group 1). 16S rRNA gene sequence analysis revealed genetic group 2 isolate AL-02-36T, genetic group 3 isolate 90-106T, and genetic group 4 isolate Costa Rica 04-02-TNT shared less than <98.8 % sequence identity to F. columnare ATCC 23463T. Phylogenetic analyses of 16S rRNA and gyrB genes using different methodologies demonstrated the four genetic groups formed well-supported and distinct clades within the genus Flavobacterium. The average nucleotide identity (ANI) and digital DNA-DNA hybridization (GGDC) values between F. columnare ATCC 23463T, genetic group 2 isolate AL-02-36T, genetic group 3 isolate 90-106T, and genetic group 4 isolate Costa Rica 04-02-TNT were less than 90.84% and 42.7%, respectively. Biochemical and physiological characteristics were similar among the four genetic groups; however, quantitative differences in fatty acid profiles were detected and MALDI-TOF analyses demonstrated numerous distinguishing peaks unique to each genetic group. Chemotaxonomic, MALDI-TOF characterization and ANI/GGDC calculations afforded differentiation between the genetic groups, indicating each group is a discrete species. Herein, the names F. covae sp. nov. (AL-02-36T), F. davisii sp. nov. (90-106T), and F. oreochromis sp. nov. (Costa Rica 04-02-TNT) are proposed to represent genetic groups 2, 3, and 4, respectively. 相似文献
14.
R. A. Cramer P. F. Byrne M. A. Brick L. Panella E. Wickliffe H. F. Schwartz 《Journal of Phytopathology》2003,151(6):352-360
Fusarium wilt is an economically important fungal disease of common bean and sugar beet in the Central High Plains (CHP) region of the USA, with yield losses approaching 30% under appropriate environmental conditions. The objective of this study was to characterize genetic diversity and pathogenicity of isolates of Fusarium oxysporum obtained from common bean and sugar beet plants in the CHP that exhibited Fusarium wilt symptoms. A total of 166 isolates of F. oxysporum isolated from diseased common bean plants were screened for pathogenicity on the universal susceptible common bean cultivar ‘UI 114’. Only four of 166 isolates were pathogenic and were designated F. oxysporum f.sp. phaseoli (Fop). A set of 34 isolates, including pathogenic Fop, F. oxysporum f.sp. betae (Fob) isolates pathogenic on sugar beet, and non‐pathogenic (Fo) isolates, were selected for random‐amplified polymorphic DNA (RAPD) analysis. A total of 12 RAPD primers, which generated 105 polymorphic bands, were used to construct an unweighted paired group method with arithmetic averages dendrogram based on Jaccard's coefficient of similarity. All CHP Fop isolates had identical RAPD banding patterns, suggesting low genetic diversity for Fop in this region. CHP Fob isolates showed a greater degree of diversity, but in general clustered together in a grouping distinct from Fop isolates. As RAPD markers revealed such a high level of genetic diversity across all isolates examined, we conclude that RAPD markers had only limited usefulness in correlating pathogenicity among the isolates and races in this study. 相似文献
15.
Aims: To develop an in vitro screening method to be used for identifying potential effective chemotherapeutants to control Aeromonas hydrophila infections. Methods and Results: Using catfish gill cells G1B and four chemicals (hydrogen peroxide, sodium chloride, potassium permanganate and d ‐mannose), the feasibility of using an in vitro screening method to identify potential effective chemotherapeutants was evaluated in this study. In vitro screening results revealed that, at concentration of 100 mg l?1, H2O2 was the only chemical tested that was able to completely abolish the attachment and invasion of Aer. hydrophila to catfish gill cells. In vivo virulence studies using live channel catfish through bath immersion confirmed that H2O2 was the only chemical tested that was able to significantly (P < 0·001) reduce the mortality (from 90 or 100% to 0 or 20%) caused by Aer. hydrophila infections. Conclusions: The in vitro screening method using catfish gill cells G1B could be used to initially identify potential effective chemotherapeutants to control Aer. hydrophila. Significance and Impact of the Study: An in vitro screening method using catfish gill cells to identify potential effective chemotherapeutants described here will cut cost in research compared with the method of using live fish to screen lead compounds for fish disease control. 相似文献
16.
A specific and rapid PCR detection method for Flavobacterium columnare based on the 16S-23S rDNA intergenic spacer region (ISR) of the ribosomal RNA operon has been developed. The ISR of 30 F. columnare strains and other Flavobacterium species was amplified using universal primers and sequenced. Once F. columnare specific sequences within the ISR were recognized, specific PCR primers were designed against them (FCISRFL and FCISRR1). The primers were sensitive and able to detect as low as 7 colony forming units from pure culture by PCR. The new PCR detection method was applied to experimentally infected channel catfish. Two different experiments in which channel catfish fingerlings were infected by intramuscular injection or by immersion bath showed the advantage of the PCR method over standard culture techniques. F. columnare was detected by PCR in both tank water and catfish tissue samples with a higher frequency and in less time than standard microbiological methods. Furthermore, PCR detection confirmed that F. columnare can be transmitted horizontally indirectly through the water column without fish-to-fish contact. The newly developed PCR detection method for F. columnare was more sensitive and rapid than standard culture on bacteriological media for detection of F. columnare in channel catfish tissues and in tank water. 相似文献
17.
M. G. S. Zanotti M. V. de Queiroz J. K. dos Santos R. B. Rocha E. G. de Barros E. F. Araújo 《Journal of Phytopathology》2006,154(9):545-549
Twenty isolates of Fusarium oxysporum from Brazil, pathogenic and non‐pathogenic to common bean, were analysed using random amplified polymorphic DNA (RAPDs) to study the genetic diversity. RAPD analysis using 23 oligonucleotides resulted in the amplification of 229 polymorphic and 7 monomorphic DNA fragments ranging from 234 to 2590 bp. High genetic variability was observed among the isolates, with the distances varying between 8% and 76% among pathogenic, 2% and 63% among the non‐pathogenic and 45% and 76% between pathogenic and non‐pathogenic isolates. The analysis of genetic distance data showed that the pathogenic isolates tended to group in one group and the non‐pathogenic in another. The genetic distance values of 30% among the pathogenic isolates in cluster A are compatible with the genetic distance values observed within the physiological races, but the distance values among the pathogenic isolates in clusters B and G are not compatible with the distance values observed within the race. Although our results are preliminary, it was not possible to exclude the existence of more than one race of this fungus in Brazil. 相似文献
18.
Eight primer combinations were used to investigate the application of amplified fragment length polymorphism (AFLP) markers
in catfish for genetic analysis. Intraspecific polymorphism was low among channel catfish or blue catfish strains. Interspecific
AFLP polymorphism was high between the channel catfish and blue catfish. Each primer combination generated from 70 to more
than 200 bands, of which 38.6–75.7% were polymorphic between channel catfish and blue catfish. On average, more than 20 polymorphic
bands per primer combination were produced as quality markers suitable for genetic analysis. All AFLP markers were transmitted
into channel catfish × blue catfish F1 hybrids, except rare markers that were heterozygous in the parents and therefore were
segregating in F1 hybrids. The two reciprocal channel catfish × blue catfish F1 hybrids (channel catfish female × blue catfish
male; blue catfish female × channel catfish male) produced identical AFLP profiles. The AFLP markers were inherited and segregated
in expected Mendelian ratios. At two loci, E8-b9 and E8-b2, markers were found at significantly lower frequencies than expected
with F2 and backcross hybrids which had been selected for increased growth rates. The reproducibility of AFLP was excellent.
These characteristics of the catfish AFLP markers make them highly useful for genetic analysis of catfish, especially for
construction of genetic linkage and quantitative trait loci maps, and for marker-assisted selection.
Received: 10 September 1997 / Accepted: 10 December 1997 相似文献
19.
C. Marois C. Fablet O. Gaillot H. Morvan F. Madec M. Kobisch 《Journal of applied microbiology》2009,107(6):1830-1836
Aims: To examine the variability among Pasteurella multocida strains isolated from pigs (nasal, tonsil and lung specimens) and humans in France. Methods and Results: The genetic diversity of 117 French isolates of P. multocida, obtained from pigs (n = 101) and humans (n = 16) and three reference strains, was evaluated by pulsed‐field gel electrophoresis (PFGE) after macrorestriction with ApaI. Sixty‐four patterns were detected. The genetic relationships revealed five clusters (Aa1, Aa2, Aa3, Ab and B). The pig isolates obtained from pneumonic lungs and nasal cavities were clustered in groups Ab and Aa1, respectively (P < 0·05). Up to four different PFGE patterns were detected in the same farm. Isolates producing dermonecrotic toxins were clustered only in group Aa1, suggesting that the toxigenic isolates were more genetically homogenous than the others. Conversely, cluster Aa3 was significantly associated with human isolates even if the human isolates are spread over most of the clusters. Conclusions: Pasteurella multocida strains were genetically diverse, but pig and human isolates were significantly clustered in distinct phylogenetic groups. Significance and Impact of the Study: The discrimination index was >0·95 in both populations of human and pig isolates. Therefore, ApaI‐PFGE seems to be a useful tool for epidemiological tracing of P. multocida infections. 相似文献
20.
Sclerotinia sclerotiorum is one of the most devastating soil-inhabiting fungal plant pathogens infecting various crop plants including chickpea. Genetic
diversity of 24 isolates of S. sclerotiorum representing 10 different states of India was determined by different molecular markers and mycelial compatibility grouping
(MCG). The majority of the isolates showed more than 90% genetic similarity. Unweighted paired group method with arithmetic
average cluster analysis of DNA profiles generated by 21 RAPD primers grouped the isolates into seven categories showing high
magnitude of genetic homogeneity and showed partial correlation with geographical origin of the isolates. Identical ITS-RFLP
profiles were generated in all the isolates. Limited variability was observed among the nucleotide sequences of ITS region
of the isolates. The phylogenetic tree generated from bootstrap neighbor-joining analysis indicated that 50% of Indian populations
were distinct and grouped separately. The isolates were variable in mycelial compatibility and they were grouped into seven
MCGs, namely, MCG A, MCG B, MCG C, MCG D, MCG E, MCG F and MCG G. 相似文献