共查询到20条相似文献,搜索用时 640 毫秒
1.
2.
3.
4.
5.
6.
Structural determinants for transcriptional activation by cAMP-responsive DNA elements 总被引:28,自引:0,他引:28
P J Deutsch J P Hoeffler J L Jameson J C Lin J F Habener 《The Journal of biological chemistry》1988,263(34):18466-18472
7.
8.
9.
Rat testis P-450(17)alpha cDNA: the deduced amino acid sequence, expression and secondary structural configuration 总被引:1,自引:0,他引:1
M Namiki M Kitamura E Buczko M L Dufau 《Biochemical and biophysical research communications》1988,157(2):705-712
A complete amino acid sequence for rat testis P-450(17)alpha was deduced from nucleotide analysis of a cDNA clone isolated from a rat Leydig cell cDNA library. This DNA clone, containing initiation and termination codons and a polyA tail, translated a polypeptide in COS-1 cells that expressed both 17 alpha-hydroxylase and 17,20 lyase activities. It exhibited significant similarity to the nucleotide and deduced amino acid sequences of the bovine and human cytochrome P-450(17)alpha, particularly with respect to the highly conserved regions and secondary structure. The P-450(17)alpha appears to be anchored to the membrane of the endoplasmic reticulum through two transmembrane regions, specifically the N terminal insertion peptide and the stop-transfer sequence. Hydropathic analysis indicates that the remainder of the C terminus is associated with the membrane through four hydrophobic clefts, including the putative steroid binding site. 相似文献
10.
11.
K D Bradshaw M R Waterman R T Couch E R Simpson M X Zuber 《Molecular endocrinology (Baltimore, Md.)》1987,1(5):348-354
To provide a basis for investigation of the molecular mechanisms underlying the hormonal regulation of steroid 17 alpha-hydroxylase (P-450 17 alpha) activity in adrenal, ovary, and testis as well as human 17 alpha-hydroxylase deficiency, we have isolated from a human fetal adrenal cDNA library a cDNA sequence complementary to the mRNA that encodes the human P-450 17 alpha enzyme. Of 75,000 colonies from the library that were screened by use of a nick-translated 5'-specific bovine P-450 17 alpha cDNA probe, 10 positive colonies were isolated and the clone with the longest insert (pcD-17 alpha H) was selected for further characterization. pcD-17 alpha H encodes the complete human P-450 17 alpha protein having approximately 78% homology at the nucleotide level and 71% homology at the amino acid level when the sequence of pcD-17 alpha H is compared to the bovine P-450 17 alpha cDNA sequence. By transient expression of the human P-450 17 alpha cDNA clone in COS 1 cells, we have demonstrated that the 17 alpha-hydroxylase and 17,20 lyase activities reside within the same human P-450 17 alpha polypeptide chain. The insert was also used as a probe to investigate, by means of Southern blot analysis, possible alterations in the P-450 17 alpha gene sequence in DNA isolated from skin fibroblasts from three patients with clinically characterized 17 alpha-hydroxylase deficiencies. No changes were detected in the DNA of any of the patients by this analysis. 相似文献
12.
In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS) 相似文献
13.
J Lund D J Faucher S P Ford J C Porter M R Waterman J I Mason 《The Journal of biological chemistry》1988,263(31):16195-16201
The developmental expression of adrenocortical steroid hydroxylases was studied in bovine fetuses from 40 to 280 days gestational age. The expression of P-450(17 alpha) is first detected at a gestational age of 50 days and reaches a maximum at 60-70 days. The expression of P-450(17 alpha) then declines and is nondetectable at a gestational age of 100 days. P-450(17 alpha) is not expressed again until about 240 days, i.e. shortly before birth (approximately 280 days). P-450scc, P-450c21, P-450(11 beta) and adrenodoxin were present in fetal adrenals throughout gestation. This "on-off-on" pattern of P-450(17 alpha) expression during fetal development was associated with a corresponding episodic production of cortisol. Immunoreactive corticotropin (ACTH) levels in fetal plasma were elevated in small fetuses (corresponding to less than or equal to 100 days) and in near-term fetuses (corresponding to greater than 250 days) compared with those in mid-gestation fetuses. In primary culture, adrenal cells from mid-gestation fetuses contained no detectable P-450(17 alpha) but rapidly responded to ACTH with an increase in P-450(17 alpha) protein and mRNA. The tissue specificity of the developmental patterns is emphasized by the fact that both P-450(17 alpha) and P-450scc were detectable throughout the development of the fetal testes, whereas only P-450scc was detectable in fetal bovine ovary prior to 200 days. Thus, in fetal bovine adrenal it appears that ACTH is the major regulatory factor effecting the intermittent presence of P-450(17 alpha), whereas the presence of the other steroid hydroxylases is either regulated by additional factors or shows a much different sensitivity to ACTH. 相似文献
14.
15.
The preparation, testing and use of a variety of cholesterol-, deoxycorticosterone (DOC)- and pregnenolone-binding 1,6-diaminohexyl (EAH)-Sepharose 4B supports for affinity column chromatography of cytochromes P-450(scc) and P-450(17 alpha) from bovine adrenal and pig testis are described. EAH-Sepharose 4B has free amino groups at the end of a 10-atom spacer arm. Hydroxyl groups of cholesterol (3 beta), deoxycorticosterone (21 beta) and pregnenolone (3 beta) are linked to succinic anhydride in pyridine through an ester linkage. These coupling ligands of hemisuccinate were synthesized by a general procedure. Free amino groups of EAH-Sepharose 4B were used to couple ligands, containing carboxyl groups, by the carbodiimide coupling method. Both the purified cytochromes P-450(scc) and P-450(17 alpha) were found to be homogeneous and estimated to have a molecular weight of 52,000 on polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. The carbon monoxide difference spectra with peaks at 450 and 448 nm exhibit the absorption spectra of typical cytochromes P-450(scc) and P-450(17 alpha), respectively. Cytochromes P-450(scc) and P-450(17 alpha) were determined to have isoelectric points of 8.0 and 6.5 in isoelectric focusing on a pH gradient gel. Cytochrome P-450s can be purified between 425- and 1000-fold from the crude extracts. 相似文献
16.
17.
Four independent clones containing a part of the P-450(SCC), cholesterol desmolase, gene were isolated from human genomic libraries using bovine P-450(SCC) cDNA as a probe. These clones covered the entire P-450(SCC) gene except for a part of the 1st intron. The gene is at least 20 kb long and is split into 9 exons by 8 introns. The sequence analysis revealed that the nine separated exons code for a primary structure consisting of 521 amino acids which shows 72% homology with that of bovine P-450(SCC). A CATT sequence and a TATAAT sequence, which are possibly a "CAT" box, and a "TATA" box, respectively, are present 129 and 91 bp upstream from the initiation codon. An unusual exon/intron junctional sequence that begins with GC was found in the 6th intron of the gene. A putative extension peptide consisting of 39 amino acids was found in the sequence of human P-450(SCC) by comparison with that of the bovine counterpart. Two conserved regions were found in the extension peptide of these two forms of P-450(SCC), suggesting a functional role of the portions in the mitochondrial localization and processing of P-450(SCC) precursor. The mature form of human P-450(SCC) has only one cysteine residue, which was located in the center of the HR2 region (Gotoh et al. (1983) J. Biochem. 97, 807-817). This observation established beyond doubt that the sole cysteine residue in the HR2 region is the 5th ligand to the heme. 相似文献
18.
W H Houser C K Cunningham R N Hines W I Schaeffer E Bresnick 《Archives of biochemistry and biophysics》1987,259(1):215-223
The induction of cytochrome P-450c, the isozyme most closely associated with aryl hydrocarbon hydroxylase activity in the rat, is mediated through a cytosolic polycyclic aromatic hydrocarbon (PAH)-binding protein(s). We have reported on the purification and characterization of a 4 S protein that interacts in a specific and saturable manner with [3H]benzo[a]pyrene and other PAHs. (W. H. Houser et al. (1985) Biochemistry 24, 7839-7845). We have also reported on the specific and saturable interaction of the 4 S protein with a plasmid containing 1.9 kbp of cloned rat P-450c sequence including exon 1, the 5' half of intron 1, and approximately 882 bp upstream information. Our investigations now show that incubation of this protein with a portion of the rat P-450c gene, followed by digestion with either lambda exonuclease or exonuclease III, tentatively identified two protected regions at -225 and -455 bp 5' from exon 1. To further study the significance of these protected regions, a 3.4-kbp fragment containing cytochrome P-450c promoter and 5'-upstream sequences (-882 to +2545) was fused to the chloramphenicol acetyl transferase (CAT) reporter gene and transfected into either rat epithelial RL-PR-C cells or rat hepatoma H-4-II-E cells. Both cell lines expressed CAT activity in response to induction by 3-methylcholanthrene (3MC), indicating that important regulatory regions responsive to 3MC are present in these constructs. However, neither cell line expressed CAT activity in response to 3MC when transfected with plasmids containing deletions (-95 to -724 or -240 to -720) in the regions shown to be protected by our footprinting studies. These results corroborate previous studies which indicated that the 4 S PAH-binding protein interacts in a specific manner with regions of the rat cytochrome P-450c gene. We conclude that the 4 S protein may play an important role in the regulation of expression of cytochrome P-450c in the rat. 相似文献
19.
Regulation of cytochromes P-450 21-hydroxylase (P-450C21) and P-450 17 alpha-hydroxylase/C17,20-lyase (P-450(17) alpha,lyase) activities and impairment of this regulation by Aroclor 1254 was studied in guinea-pig adrenal microsomes. In a membrane depleted system, a decrease in the normally predominant, P-450C21 activity and an increase in P-450(17) alpha,lyase activities was observed. The same deviations were observed in intact microsomes with increase in the reaction temperature (0-40 degrees C). Breaks in Arrhenius plots for activities of P-450C21 and P-450(17) alpha,lyase correlate with transition temperatures reported for the microsomal membrane. These results point to: (1) preference of a gel state membrane for catalytic expression of P-450C21 suggesting a clustered organization of this P-450 species with reductase; (2) preference of a fluid membrane for lyase activity suggesting a random collision mechanism for reduction of P-450(17) alpha,lyase. Aroclor 1254 introduced to reaction mixtures containing intact microsomes elicited basically the same changes as caused by depletion of the microsomal membrane or by increase in the incubation temperature. Lack of effect of Aroclor 1254 on P-450C21 and P-450(17) alpha,lyase activities in the membrane depleted system demonstrates that its interference with monooxygenase activities is mediated by the microsomal membrane. The similarities between altered cytochrome P-450 mediated activities in the presence of Aroclor 1254 and the deviations observed in the membrane depleted system or upon increase in the incubation temperature may suggest that this chemical exerts its impacts by influencing membrane fluidity. 相似文献